Genetic Analysis of Methylenetetrahydrofolate Reductase (MTHFR) Gene of Polymorphism (rs1801133) in Patients with Non-Syndromic Cleft lip and Palate in the South Indian Population. A Preliminary Case Control Study
DOI:
https://doi.org/10.15517/y7gfgs79Keywords:
MTHFR gene; rs1801133; Non syndromic; Cleft lip and palate; Polymorphism; Genetic variation.Abstract
To identify if an association exists between MTHFR gene polymorphism (rs1801133) and non-syndromic cleft lip (NSCLP) and palate in patients belonging to the South Indian population. 25 patients with NSCLP and 25 healthy patients as controls were enrolled in the study. Genotyping of rs1801133 polymorphism was performed with PCR and amplification refractory mutation system. The primers used were MTHFR-Forward: 5’- TGCTGTTGGAAGGTGCAAGAT - 3’, MTHFRR1: 5’ - GCGTGATGATGAAATCGG - 3’ and MTHFRR2: 5’ - GCGTGATGATGAAATCGA - 3’. Cycling was carried out with an annealing temperature of 58 degree C for 30 seconds Genotype and allele frequency distributions in both the groups were compared using Chi-square test. The frequency of the GA was 100% without GG and AA genotype in group 1 (case group). The allele frequency in group 2 (control group) was found to be GG=24% and GA=76%. The GG homozygous genotype was absent in the case group, whereas the AA homozygous genotype was absent in boths groups. There was a statistically significant deviation from Hardy Weinberg Equilibrium with a p value of <0. 00001 and <0.0022 in the case group control group respectively. Both the groups showed a deviation in Hardy- Weinberg equilibrium depicting an evolving genotyping variant in the South Indian population. Classification of the genotypes based on genetic models such as dominant, recessive or additive did not present any significant association of the polymorphism marker with disease status.
Downloads
References
Farronato G., Cannalire P., Martinelli G., Tubertini I., Giannini L., Galbiati G., Maspero C. Cleft lip and/or palate: review. Minerva Stomatol. 2014; 63: 111-26.
Vyas T., Gupta P., Kumar S., Gupta R., Gupta T., Singh H.P. Cleft of lip and palate: A review. J Family Med Prim Care. 2020; 9: 2621-25. DOI: https://doi.org/10.4103/jfmpc.jfmpc_472_20
Martinelli M., Palmieri A., Carinci F., Scapoli L. Non-syndromic Cleft Palate: An Overview on Human Genetic and Environmental Risk Factors. Front Cell Dev Biol. 2020; 20: 592271. DOI: https://doi.org/10.3389/fcell.2020.592271
Venkatesh R. Syndromes and anomalies associated with cleft. Indian J Plast Surg. 2009; 42: S51-5. DOI: https://doi.org/10.4103/0970-0358.57187
De Cuyper E., Dochy F., De Leenheer E., Van Hoecke H. The impact of cleft lip and/or palate on parental quality of life: A pilot study. Int J Pediatr Otorhinolaryngol. 2019: 109598. DOI: https://doi.org/10.1016/j.ijporl.2019.109598
Putri F.A., Pattamatta M., Anita S.E.S., Maulina T. The Global Occurrences of Cleft Lip and Palate in Pediatric Patients and Their Association with Demographic Factors: A Narrative Review. Children (Basel). 2024; 11: 322. DOI: https://doi.org/10.3390/children11030322
Murray J.C. Gene/environment causes of cleft lip and/or palate. Clinical genetics. 2002; 61: 248-56. DOI: https://doi.org/10.1034/j.1399-0004.2002.610402.x
Abdollahi-Fakhim S., Asghari Estiar M., Varghaei P., Alizadeh Sharafi M., Sakhinia M., Sakhinia E. Common Mutations of the Methylenetetrahydrofolate Reductase (MTHFR) Gene in Non-Syndromic Cleft Lips and Palates Children in North-West of Iran. Iran J Otorhinolaryngol. 2015; 27: 7-14.
Davis W.H. Development of a high-throughput genotyping assay for detection of functional polymorphisms involved in homocysteine metabolism and the methylation process implicated in multiple sclerosis (Doctoral dissertation, Stellenbosch: Stellenbosch University).
Lupi-Herrera E., Soto-López M.E., Lugo-Dimas A.J., Núñez-Martínez M.E., Gamboa R., Huesca-Gómez C., Sierra-Galán L.M., Guarner-Lans V. Polymorphisms C677T and A1298C of MTHFR Gene: Homocysteine Levels and Prothrombotic Biomarkers in Coronary and Pulmonary Thromboembolic Disease. Clin Appl Thromb Hemost. 2019; 25: 1076029618780344. DOI: https://doi.org/10.1177/1076029618780344
Zarembska E., Ślusarczyk K., Wrzosek M. The Implication of a Polymorphism in the Methylenetetrahydrofolate Reductase Gene in Homocysteine Metabolism and Related Civilisation Diseases. Int J Mol Sci. 2023; 25: 193.
Blanton S.H., Henry R.R., Yuan Q., Mulliken J.B., Stal S., Finnell R.H., Hecht J.T. Folate pathway and nonsyndromic cleft lip and palate. Birth Defects Res A Clin Mol Teratol. 2011; 91: 50-60. DOI: https://doi.org/10.1002/bdra.20740
Li Q., Xu L., Jia X., Saleem K., Zaib T., Sun W., Fu S. SNPs in folate pathway are associated with the risk of nonsyndromic cleft lip with or without cleft palate, a meta-analysis. Biosci Rep. 2020; 27; 40: BSR20194261. DOI: https://doi.org/10.1042/BSR20194261
Zheng Y., Cantley L.C. Toward a better understanding of folate metabolism in health and disease. J Exp Med. 2019; 216: 253-266. DOI: https://doi.org/10.1084/jem.20181965
Friso S., Choi S.W., Girelli D., Mason J.B., Dolnikowski G.G., Bagley P.J., Olivieri O., Jacques P.F., Rosenberg I.H., Corrocher R., Selhub J. A common mutation in the 5,10-methylenetetrahydrofolate reductase gene affects genomic DNA methylation through an interaction with folate status. Proc Natl Acad Sci U S A. 2002; 99: 5606-11. DOI: https://doi.org/10.1073/pnas.062066299
Zarembska E., Ślusarczyk K., Wrzosek M. The Implication of a Polymorphism in the Methylenetetrahydrofolate Reductase Gene in Homocysteine Metabolism and Related Civilisation Diseases. International Journal of Molecular Sciences. 2024; 25: 193. DOI: https://doi.org/10.3390/ijms25010193
Fabbri E., Rustignoli L., Muscari A., Puddu G.M., Guarino M., Rinaldi R., Minguzzi E., Caio G., Zoli M., Volta U. Recurrent ischemic strokes in a young celiac woman with MTHFR gene mutation. World J Gastroenterol. 2012; 18: 3472-6. DOI: https://doi.org/10.3748/wjg.v18.i26.3472
Meng Y., Liu X., Ma K., Zhang L., Lu M., Zhao M., Guan M.X., Qin G. Association of MTHFR C677T polymorphism and type 2 diabetes mellitus (T2DM) susceptibility. Mol Genet Genomic Med. 2019;7: e1020. DOI: https://doi.org/10.1002/mgg3.1020
Lu M., Peng K., Song L., Luo L., Liang P., Liang Y. Association between Genetic Polymorphisms in Methylenetetrahydrofolate Reductase and Risk of Autoimmune Diseases: A Systematic Review and Meta-Analysis. Dis Markers. 2022: 4568145. DOI: https://doi.org/10.1155/2022/4568145
Hancock A.M., Rienzo A.D. Detecting the Genetic Signature of Natural Selection in Human Populations: Models, Methods, and Data. Annu Rev Anthropol. 2008; 37: 197-217. DOI: https://doi.org/10.1146/annurev.anthro.37.081407.085141
Desai A.L., Dinesh M.R., Amarnath B.C., Dharma R.M., Akshai K.R., Prashanth C.S. Association of Transforming Growth Factor Alpha and Methylenetetrahydrofolate reductase gene variants with nonsyndromic cleft lip and palate in the Indian population. Contemp Clin Dent. 2014; 5: 329-33. DOI: https://doi.org/10.4103/0976-237X.137932
Murthy J., Gurramkonda V.B., Karthik N., Lakkakula B.V. MTHFR C677T and A1298C polymorphisms and risk of nonsyndromic orofacial clefts in a south Indian population. Int J Pediatr Otorhinolaryngol. 2014; 78: 339-42. DOI: https://doi.org/10.1016/j.ijporl.2013.12.005
Avasthi K.K., Agarwal A., Agarwal S. Association of MTHFR, BMP4, TGFA and IRF6 Polymorphisms with Non-Syndromic Cleft lip and Palate in North Indian Patients. Avicenna J Med Biotechnol. 2022; 14: 175-180. DOI: https://doi.org/10.18502/ajmb.v14i2.8879
Komiyama Y., Koshiji C., Yoshida W., Natsume N., Kawamata H. 5,10-Methylenetetrahydrofolate reductase (MTHFR) C677T/A1298C polymorphisms in patients with nonsyndromic cleft lip and palate. Biomed Rep. 2020; 6: 57. DOI: https://doi.org/10.3892/br.2020.1364
Rafik A., Rachad L., Kone A.S., Nadifi S. MTHFR C677T polymorphism and risk of nonsyndromic cleft lip with or without cleft palate in the Moroccan population. Appl Clin Genet. 2019; 7: 51-54. DOI: https://doi.org/10.2147/TACG.S194166
Estandia-Ortega B., Velázquez-Aragón J.A., Alcántara-Ortigoza M.A., Reyna-Fabian M.E., Villagómez-Martínez S., González-Del Angel A. 5,10-Methylenetetrahydrofolate reductase single nucleotide polymorphisms and gene-environment interaction analysis in non-syndromic cleft lip/palate. Eur J Oral Sci. 2014; 122: 109-13. DOI: https://doi.org/10.1111/eos.12114
Martinelli M., Girardi A., Cura F., Nouri N., Pinto V., Carinci F., Morselli P.G., Salehi M., Scapoli L. Non-syndromic cleft lip with or without cleft palate in Asian populations: Association analysis on three gene polymorphisms of the folate pathway. Arch Oral Biol. 2016; 61: 79-82. DOI: https://doi.org/10.1016/j.archoralbio.2015.10.019
Ebadifar A., Ameli N., Khorramkhorshid H.R., Salehi Zeinabadi4 M., Kamali K., Khoshbakht T. Incidence Assessment of MTHFR C677T and A1298C Polymorphisms in Iranian Non-syndromic Cleft Lip and/or Palate Patients. J Dent Res Dent Clin Dent Prospects. 2015; 9: 101-4. DOI: https://doi.org/10.15171/joddd.2015.020
Ebadifar A., KhorramKhorshid H.R., Kamali K., Salehi Zeinabadi M., Khoshbakht T., Ameli N. Maternal Supplementary Folate Intake, Methylenetetrahydrofolate Reductase (MTHFR) C677T and A1298C Polymorphisms and the Risk of Orofacial Cleft in Iranian Children. Avicenna J Med Biotechnol. 2015; 7: 80-4.
Abdollahi-Fakhim S., Asghari Estiar M., Varghaei P., Alizadeh Sharafi M., Sakhinia M., Sakhinia E. Common Mutations of the Methylenetetrahydrofolate Reductase (MTHFR) Gene in Non-Syndromic Cleft Lips and Palates Children in North-West of Iran. Iran J Otorhinolaryngol. 2015; 27: 7-14.
Jahanbin A., Hasanzadeh N., Abdolhoseinpour F., Sadr-Nabavi A., Raisolsadat M.A., Shamsian K., Mohajertehran F., Kianifar H. Analysis of MTHFR Gene C.677C>T and C.1298A>C Polymorphisms in Iranian Patients with Non-Syndromic Cleft Lip and Palate. Iran J Public Health. 2014; 43: 821-7.
Carinci F., Palmieri A., Scapoli L., Cura F., Borelli F., Morselli P.G., Nouri N., Abdali H., Gianni A.B., Russillo A., Docimo R., Martinelli M. Non-syndromic cleft palate: Association analysis on three gene polymorphisms of the folate pathway in Asian and Italian populations. Int J Immunopathol Pharmacol. 2019; 33: 2058738419858572. DOI: https://doi.org/10.1177/2058738419858572
Ramírez-Chau C., Blanco R., Colombo A., Pardo R., Suazo J. MTHFR c.677C>T is a risk factor for non-syndromic cleft lip with or without cleft palate in Chile. Oral Dis. 2016; 22: 703-8. DOI: https://doi.org/10.1111/odi.12533
Nan X., Liu M., Yuan G. Relationship between genetic polymorphism of MTHFR C677T and nonsyndromic cleft lip with or without cleft palate in Shanxi Province of China]. Zhonghua Zheng Xing Wai Ke Za Zhi. 2014; 30: 265-9.
Amooee A., Dastgheib S.A., Niktabar S.M., Noorishadkam M., Lookzadeh M.H., Mirjalili S.R., Heiranizadeh N., Neamatzadeh H. Association of Fetal MTHFR 677C > T Polymorphism with Non-Syndromic Cleft Lip with or without Palate Risk: A Systematic Review and Meta-Analysis. Fetal Pediatr Pathol. 2021; 40: 337-353. DOI: https://doi.org/10.1080/15513815.2019.1707918
Rai V. Strong Association of C677T Polymorphism of Methylenetetrahydrofolate Reductase Gene with Nosyndromic Cleft Lip/Palate (nsCL/P). Indian J Clin Biochem 2018; 33: 5-15. DOI: https://doi.org/10.1007/s12291-017-0673-2
Natarajan P.G., Mahipathy S.R., Nalabothu P. Anatomic Subunit Cleft Lip Repair: New Repair Concept Based on Nostril Sill and Philtrum-White Roll Junction. Journal of Craniofacial Surgery. 2024; 35:2463-5. DOI: https://doi.org/10.1097/SCS.0000000000010620
Alkadhi O.H., Alotaibi L.H., Alrashoud R.R., Almutairi M.H., Al Matar H.A., Mallineni S.K. Effect of Maxillary Expansion on the Maxillary Arch Width in Patients with Bilateral Cleft Palate: A Review. Children. 2023; 10: 762. DOI: https://doi.org/10.3390/children10050762
da Silva Filho, O.G. ∙ Teles, S.G. ∙ Ozawa, T.O. Secondary bone graft and eruption of the permanent canine in patients with alveolar clefts: literature review and case report. Angle Orthod. 2000; 70:174-178
Tindlund, R.S. ∙ Rygh, P. ∙ Boe, O.E. Orthopedic protraction of the upper jaw in cleft lip and palate patients during the deciduous and mixed dentition periods in comparison with normal growth and development. Cleft Palate Craniofac J. 1993; 30:182-194 DOI: https://doi.org/10.1597/1545-1569_1993_030_0182_opotuj_2.3.co_2
Robin N.H., Baty H., Franklin J., Guyton F.C., Mann J., Woolley A.L., Waite P.D., Grant J. The multidisciplinary evaluation and management of cleft lip and palate. South Med J. 2006; 99: 1111-20. DOI: https://doi.org/10.1097/01.smj.0000209093.78617.3a
Frederick R., Hogan A.C., Seabolt N., Stocks R.M.S. An Ideal Multidisciplinary Cleft Lip and Cleft Palate Care Team. Oral Dis. 2022; 28: 1412-1417. DOI: https://doi.org/10.1111/odi.14213
Anishya D., Nagesh S. Assessment of Nasal Aesthetic Parameters in Patients with Unilateral Cleft Lip and Palate–A Retrospective Study. The Cleft Palate Craniofacial Journal. 2024; 11:10556656241261908. DOI: https://doi.org/10.1177/10556656241261908
Jaber M., Alshikh Ali A.M., El Saleh R.I., Prasad P. The Use of Stem Cells in Bone Regeneration of Cleft Lip and Palate Patients: A Systematic Review. Journal of Clinical Medicine. 2024; 13: 5315. DOI: https://doi.org/10.3390/jcm13175315
Tovani-Palone M.R. Management of orofacial clefts in times of artificial intelligence: advances and challenges. European Archives of Paediatric Dentistry. 2024; 31: 1-2. DOI: https://doi.org/10.1007/s40368-024-00916-4
Published
Issue
Section
License
Copyright (c) 2026 A. Sumathi Felicita, Kamala Devi S., Vijayashree Priyadharshini Jayaseelan.
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License.
ODOVTOS - Int. J. Dent. Sc. endorses CC BY-NC-SA
This license enables reusers to distribute, remix, adapt, and build upon the material in any medium or format for noncommercial purposes only, and only so long as attribution is given to the creator. If you remix, adapt, or build upon the material, you must license the modified material under identical terms. CC BY-NC-SA includes the following elements:
BY: credit must be given to the creator.
NC: Only noncommercial uses of the work are permitted.
SA: Adaptations must be shared under the same terms.
