636 Revista de Biología Tropical, ISSN: 2215-2075 Vol. 70: 636-646, e49716, Enero-Diciembre 2022 (Publicado Set. 09, 2022)
Antifungal potential of biosurfactants produced by strains of Bacillus spp.
(Bacillales: Bacillaceae) selected by molecular screening
Camila Olmedo1; https://orcid.org/0000-0003-2861-5093
Alma Koch1, 2; https://orcid.org/0000-0002-5213-3580
Berenice Sarmiento1; https://orcid.org/0000-0002-8840-9868
Andrés Izquierdo1, 2, 3*; https://orcid.org/0000-0001-9877-8846
1. Departamento de Ciencias de la Vida y la Agricultura, Universidad de las Fuerzas Armadas ESPE, Sangolquí,
Ecuador; pcolmedo@espe.edu.ec, almakoch@yahoo.com.mx, bcsarmiento@espe.edu.ec, arizquierdo@espe.edu.ec
(* Correspondence)
2. Grupo de Investigación en Microbiología y Ambiente (GIMA), ESPE, Sangolquí, Ecuador
3. Centro de Nanociencia y Nanotecnología (CENCINAT), ESPE, Sangolquí, Ecuador
Received 13-I-2022. Corrected 22-VI-2022. Accepted 07-IX-2022.
ABSTRACT
Introduction: Bacillus species are used as biological controllers for phytopathogenic fungi, and the mechanisms
to produce controllers include biosynthesis of lipopeptide biosurfactants with antifungal activity.
Objective: To evaluate the antifungal potential of the biosurfactants produced by Bacillus strains, selected by
molecular screening, on Fusarium oxysporum.
Methods: We selected four molecular markers, related to the biosynthesis of surfactin, fengicin, and lichenysin
(srfA, spf, fenB, LichAA) in nine Bacillus strains. We used two mineral media with several culture conditions,
for biosurfactant production, and a well diffusion test for antifungal potential.
Results: Only the biosurfactant produced by UFAB25 inhibits the mycelial growth of F. oxysporum (44 % ± 13):
this biosurfactant was positive for srfA, spf, and fenB genes involved in the synthesis of surfactin and fengicine.
Antifungal activity depends on culture conditions and the strain.
Conclusions: Genetic markers are useful to detect strains with antifungal potential, facilitating the selection of
bio-controllers. The biosurfactant profile is influenced by the strain and by culture conditions.
Key words: microbial surfactant; native strains; Bacillus subtilis; antifungal activity; molecular marker.
https://doi.org/10.15517/rev.biol.trop.2022.49716
OTRO
INTRODUCTION
The excessive use of pesticides has several
negative impacts on human health and in the
environment such as the decrease in fertility
of agricultural lands, contamination of water
sources, and affectation of fauna and flora
(Mahmood et al., 2016; Rajmohan et al., 2020;
Wilson & Tisdell, 2001). One of the main draw-
backs has been the emergence of resistance and
the involuntary destruction of natural predators
of pest organisms (Litsinger, 1989; Wilson &
Tisdell, 2001). Due to the problems associ-
ated with the use of pesticides, there is a need
to seek new sustainable and environmentally
friendly technologies in agriculture. Among
637
Revista de Biología Tropical, ISSN: 2215-2075, Vol. 70: 636-646, e49716, Enero-Diciembre 2022 (Publicado Set. 09, 2022)
such alternatives, the study and development
of biopesticides and bio-controllers stand out
(Borriss, 2011).
Bacillus genus is a group of gram-positive
bacteria forming endospore, with the abil-
ity to produce a large number of molecules
with inhibitory potential against phytopatho-
gens (Ben-Dov et al., 1997; Ogena & Jacques,
2008). These bacteria are able to colonize the
rhizosphere with beneficial effects on plants.
They can tolerate environments with high alka-
linity, acidity, salinity, and temperature (Hor-
ikoshi, 2007). Between 4 % and 5 % of Bacillus
subtilis genome is involved in the synthesis of
antibiotics, while 9 % of Bacillus amylolique-
faciens genome is dedicated to the production
of secondary metabolites that suppress harmful
microbes and nematodes (Chowdhury et al.,
2015; Ogena & Jacques, 2008)
Among the metabolites produced by the
genus Bacillus, with biocontrol properties, are
the lipopeptides of the surfactin, iturin, and
fengicin families (Mnif et al., 2015; Ogena
& Jacques, 2008). They are amphipathic mol-
ecules with surfactant properties. The latter
possessed a strong antifungal activity and sur-
factins exhibit antibacterial properties. The
coproduction of different families of lipopep-
tides generates a synergistic effect on their
biological activities (Ongena et al., 2005)
A study demonstrated that surfactins and
fengicins may be involved in the development
of induced systemic resistance (ISR) acting as
elicitors. The results suggest that they provided
a significant protective effect in bean plants,
similar to that induced by cells of the B. subtilis
strain S449 (Ogena & Jacques, 2008; Ongena
et al., 2007).
The aim of this study is to use molecular
screening to identify native strains that are able
to produce biosurfactant with antifungal poten-
tial. These strains have been collected from
different environmental sources in Ecuador and
are meant to be researched at laboratory level.
MATERIALS AND METHODS
Microorganisms: The bacterial and the
Fusarium oxysporum strains were provided by
the Environmental Microbiology Laboratory of
the Universidad de las Fuerzas Armadas ESPE
in Ecuador. The strains were isolated from dif-
ferent environmental sources such as contami-
nated soils and hydrothermal springs from the
tropical Andes of Ecuador, under the permit #
MAE-DNB-CM-2017-0071 as granted by the
Environment Ministry of Ecuador.
All the native strains were identified using
the 16S rRNA molecular marker in previous
studies (Table 1). The microorganisms were
reactivated following the protocol of Freire
& Sato (1999). Streaking technique was per-
formed in Nutrient Agar to confirm colony
morphology and Gram staining.
Hemolytic activity: It is a qualitative,
rapid screening method used to identify bio-
surfactant-producing microorganisms (Thavasi,
TABLE 1
Bacilllus spp. strains and their environmental sources
Strain Species (16S rRNA) Environmental sources
UFAB19 B. licheniformis Hydrothermal spring “Aguas Hediondas”- Province Carchi
UFAB25 B. subtilis Hydrocarbons contaminated soil “El Rosario Quinindé – Province Esmeraldas”
UFAB28 B. megaterium
UFAB31 B. toyanensis
UFAB29.1 B. cereus
UFAB18 B. licheniformis Hydrothermal spring “Guapán” – Province Cañar
UFAB29 B. subtilis Hydrothermal spring “El Riñón”- Province Azuay
UFAB26 B. circulans
UFAB37 B. licheniformis Hydrothermal spring “El Salado”- Province Tungurahua
638 Revista de Biología Tropical, ISSN: 2215-2075 Vol. 70: 636-646, e49716, Enero-Diciembre 2022 (Publicado Set. 09, 2022)
et al., 2007; Youssef et al., 2004). The test was
performed on blood agar plates, where each
strain was streaked onto blood agar plates and
incubated at 37 °C for 42 h. Subsequently, beta
hemolysis (clear area) was identified around
the colonies as a positive result for the produc-
tion of biosurfactants, according to the protocol
proposed by Youssef et al. (2004) with some
modifications. Hereby, the notation “-” was
used for no hemolysis, “+”; for incomplete
hemolysis (greenish area), “++”; for complete
hemolysis with a lysis diameter less than 1 cm,
and “+++”; for complete hemolysis with a lysis
diameter greater than or equal to 1 cm.
Molecular screening: Bacterial genomic
DNA was extracted from a 24 h culture of each
strain using the modified protocol of Jarrin
(2010). The quality of DNA was determined
by the A260/A280 absorbance ratio, consider-
ing values of 1.8-2 as pure DNA (Sambrook &
Russell, 2001). Finally, DNA concentrations
were adjusted to 40 ng/µL.
PCR was performed for each gene (srf,
srfAA, fenB, and LinchAA). Primers and
annealing temperatures are listed in Table 2.
PCRs were conducted in a total volume of 25
µL with 6.5 µL of nuclease-free water, with
12.5 µL of GoTaq® Green Master Mix 2X
Promega, 0.6 µM of each primer, and 3 µL of
genomic DNA. PCR programs were at 95 °C
for 2 min, with 35 cycles of 95 °C for 30 s,
while annealing temperature for 30 s and 72 °C
for 30 s. A final extension step was realized at
72 °C for 7 min, followed by storage tempera-
ture at 4 °C. PCR products were visualized on
an agarose gel.
Biosurfactant production and extrac-
tion: Based on the results obtained in the molec-
ular screening and hemolytic activity, three
strains (UFAB 19, UFAB 29, UFAB25) were
selected out of nine. Subsequently, two proto-
cols were used for biosurfactant production.
Protocol one: The inoculum was prepared
according to the protocol used by Ghribi &
Ellouze-Chaabouni (2011). Each strain was
inoculated into 3 mL of LB medium and incu-
bated at 37 °C overnight. A 0.2 mL aliquot
was inoculated into 50 mL of LB medium in a
250 mL Erlenmeyer flask and incubated with
shaking at 37 °C until an absorbance of 3 was
reached at a wavelength of 600 nm. An aliquot
of the culture was inoculated in a mineral medi-
um until an initial optical density of 0.15 cor-
responding to 0.8 x 107 CFU/mL was reached.
The optimized medium, proposed by Mnif
et al. (2013), was used. It contains 15 g/L
glucose, 7.5 g/L urea, 1 g/L K2HPO4, 1 g/L
ammonium sulfate, 0.5 g/L NaCl, 0.2 g/L
MgSO4, 0.5 g/L KH2PO4, and 0.001 g/L of
TABLE 2
Primers used in molecular screening
Bio-
Surfactant Gen Primer – Sequence 5’- 3’ bp Annealing
temperature Reference
Surfactin sfp F-5’ ATGAAGATTTACGGAATTTA 3’ 675 46 ºC Hsieh et al. (2004)
R-5’ TTATAAAAGCTCTTCGTACG 3’
srf-AA F-5’ TCGGGACAGGAAGACATCAT 3’ 200 55 ºC Chung et al. (2008)
R-5’ CCACTCAAACGGATAATCCTGA 3’
Fengicin fenB F-5’ CCTGGAGAAAGAATATACCGTACCY 3’ 670 57 ºC Chung et al. (2008)
R-5’ GCTGGTTCAGTT KGATCACAT 3’
Lichenysin Lich-AA F-5’ ACTGAAGCGATTCGCAAGTT 3′ 472 56.5 ºC Chung et al. (2008)
R-5’ TCGCTTCATATTGTGCGTTC 3’
PCR products were sequenced by Macrogen Korea using Sanger technology (Chan, 2005). Forward and reverse sequences
were cleaned using Geneius and Mega7 programs until an acceptable quality was obtained (HQ > 85 %). Resulting counting
sequences were compared with the tool BLAST of database NCBI (National Center of Biotechnology Information)
(Sherry et al., 2001).
639
Revista de Biología Tropical, ISSN: 2215-2075, Vol. 70: 636-646, e49716, Enero-Diciembre 2022 (Publicado Set. 09, 2022)
each of the following MnSO4, FeSO4, ZnSO4,
1 and CaCl2. The culture was conducted in 150
mL of medium in 500 mL flasks, at 30 °C, and
150 rpm for three days.
Protocol two: A second medium, described
by El-Sheshtawy et al. (2015) was tested. A 5
mL aliquot of a 24 h bacterial culture on nutri-
ent broth was used as inoculum. The medium
presented the following composition: 2 % glu-
cose, 3 % yeast extract, 2.5 g/L NaNO3, 0.1 g/L
KCl, 3.0 g/L KH2PO4, 7.0 g/L K2HPO4, 0.01
g/L CaCl2, 0.5 g/L MgSO4 x 7H2O and 5 mL of
a solution of microelements; 0.116 g/L FeSO4 *
7H2O, 0.232 g/L H3BO3, 0.41 g/L CoCl2 6H2O,
0.008 g/L CuSO4 * 5H2O, 0.008 g/L MnSO4
x H2O, 0.022 g/L [NH4]6 Mo7O24 and 0.174
g/L ZnSO4. The culture was performed in 500
mL, using completely filled screw cap flasks,
incubated at 30 ºC and 150 rpm for three days.
Surfactant production verification: The
biosurfactant production was verified using the
crude dispersion test according to the method-
ology described by Youssef et al (2004) with
modifications. 20 µL of crude oil was added to
50 mL of distilled water in a Petri dish. Then,
one drop (~ 10 µL) of cell-free culture was
added. The formation of a clear zone on the
surface of the crude oil was determined visu-
ally as positive for the production of microbial
surfactants. The formation of clear areas was
not observed with the control test when using
distilled water.
Biosurfactant extraction: The biosurfac-
tant was extracted according to Li et al. (2010)
with modifications. The broth culture was
centrifuged at 6 000 rpm for 20 min in order to
separate lipopeptides of interest from biomass.
Hereafter, supernatant was acidified to a pH of
2.0 by adding concentrated HCl and stored at a
temperature of 4 °C for 12 h. The precipitated
biosurfactant was collected by centrifugation
and recovered in methanol. Finally, the solvent
was removed by evaporation.
Antifungal potential: Agar-well diffusion
method was used to evaluate the antifungal
activity of the biosurfactant extracts. In a Plate
of Potato Dextrose Agar (PDA) four wells were
generated 3 cm away from the center of the
plate, where a mycelial plug with a diameter
of 0.5 cm of F. oxysporum was inoculated. 50
µL of methanol was placed in the control well,
then 50 µL of the biosurfactant solutions were
loaded in the rest of the wells.
The solutions tested were the following,
“Bs1”: a 50 % v/v methanol solution with
the biosurfactant produced with protocol one,
“FBs1”: an unsaturated methanol fraction
obtained from the supernatant of the “BS1”
solution after the precipitation of biosurfactant
in excess. Finally, “Bs2”: a 50 % v/v methanol
solution with the surfactant produced with
protocol two.
The inhibition of the phytopathogen
was quantified when mycelial growth had
reached the control well. The following for-
mula was used to determine mycelial growth
inhibition percentage.
I=[(C - T)/C]*100
Where “C” is the radial distance of myce-
lial growth towards the control well, “T” is the
radial distance of mycelial growth towards the
well with the extract, and “I” is the inhibition
percentage (Ramarathnam et al., 2007). The
experiments were conducted by triplicate.
A normal distribution of the data was
considered. A two-way ANOVA test and means
comparison Bonferroni test were performed
(St & Wold, 1989). The factors are strains
(UFAB25, UFAB29, UFAB19) and biosur-
factant solution (Bs1, FBs1, Bs2). Origin Pro
(OriginLab, 2018) was the program used.
RESULTS
Hemolytic activity: 55.5 % of the strains
(UFAB25, UFAB28, UFAB29.1, UFAB29, and
640 Revista de Biología Tropical, ISSN: 2215-2075 Vol. 70: 636-646, e49716, Enero-Diciembre 2022 (Publicado Set. 09, 2022)
UFAB31.5) generated complete hemolysis.
Results are listed in Table 3.
Molecular screening: A molecular
screening was used as a selection criterion
for the strains used in the production of bio-
surfactants. 22.2 % of the nine strains tested
presented the sfp and srf-AA genes, involved
in the production of surfactin. Only UFAB25
was positive for fenB gene. While 33.3 % of
the reactivated strains (UFAB25, UFAB29,
UFAB19) were positive for the Lich-AA gene.
The results of the comparison, made in BLAST
with the sequences obtained, are shown in
Table 4. The other four strains (UFAB26,
UFAB28, UFAB29.1, UFAB31) were negative
for sfp, srf-AA, Lich-AA and fenB genes.
Biosurfactant production: Strain Selec-
tion: Based on the results obtained in the
molecular screening and hemolytic activity,
three strains were selected: UFAB19 does not
show any hemolytic activity, but it has genes
associated with linchenysin biosynthesis (this
strain was used as a negative control). UFAB25
and UFB29, yielded hemolytic activity and dis-
played genes associated to fengicin and surfac-
tin. No other molecular screen-negative strains
were selected to optimize resources and work.
The production of the biosurfactant in
mineral medium was verified by the oil disper-
sion test. The largest crude oil dispersion diam-
eter of crude oil (26.3 mm) corresponded to
strain UFAB29 strain, while the dispersion area
with the smallest diameter (5.7 mm) was with
strain UFAB19, both in the mineral medium
proposed by Mnif et al. (2013). All the superna-
tants tested generated crude oil displacement,
confirming the production of biosurfactants.
Table 5 lists the results of the oil dispersion test.
Antifungal potential: The biosurfactant
produced by the UFAB25 strain (B. subtilis) in
the first mineral medium yielded the highest
percentage inhibition of mycelial growth of F.
oxysporum. The 50 % v/v methanol solution
(Bs1) had a mycelial percentage inhibition of
43.6 ± 13.16. The methanol fraction obtained
from the 50 % v/v solution (FBs1) had an aver-
age percent inhibition of 40.9 ± 12.38. While
a 50 % v/v methanol solution of biosurfactant
produced with second mineral medium (Bs2)
reaches an inhibition percentage of 19.7 ±
10.84. The solution biosurfactant produced
with UFAB29 (B. subtilis) Bs1, Bs2 and, FBs1
showed percent inhibition of 7.46 ± 2.19, 0.91
TABLE 3
Hemolytic activity results as screen for producer strains
Strains Species (16S rRNA) Hemolysis
UFAB25 B. subtilis ++
UFAB19 B. licheniformis -
UFAB29.1 B. cereus +++
UFAB31 B. toyanensis +++
UFAB28 B. megaterium ++
UFAB29 B. subtilis +++
UFAB26 B. circulans -
UFAB37 B. licheniformis -
UFAB18 B. licheniformis -
TABLE 4
Results of the comparison made of the sequencing of the PCR products in BLAST
Strains Gen Accession code % Identity Query Cover Product
UFAB25 sfp CP035397.1 99.85 100 % 4’-phosphopantetheinyl transferase
UFAB29 sfp CP032872.1 99.53 100 % 4’-phosphopantetheinyl transferase
UFAB25 srf-AA CP029609.1 97.66 98 % surfactin non-ribosomal peptide synthetase SrfAA
UFAB29 srf-AA CP032855.1 98.00 99 % surfactin non-ribosomal peptide synthetase SrfAA
UFAB25 fenB CP014858.1 99.84 99 % non-ribosomal peptide synthase
UFAB18 Lich-AA CP038186.1 100 99 % lichenysin non-ribosomal peptide synthetase LicA
UFAB19 Lich-AA CP025226.1 99.33 99 % non-ribosomal peptide synthetase
UFAB37 Lich-AA CP038186.1 100 99 % lichenysin non-ribosomal peptide synthetase LicA
641
Revista de Biología Tropical, ISSN: 2215-2075, Vol. 70: 636-646, e49716, Enero-Diciembre 2022 (Publicado Set. 09, 2022)
± 1.92 and 1.49±1.97, respectively. While Bs1
and Bs2 produced with UFAB19 (B. licheni-
formis) reach 0.46 ± 0.80 and 0.10 ± 1.17,
respectively (Fig. 1). The yield of UFAB19
biosurfactant in the mineral medium being
low, the quantity of extract was insufficient to
conduct the methanolic solutions at 50 % v/v,
consequently, the solutions were produced at a
lower concentration.
The ANOVA test established the interac-
tion between the factors. Hereby, “Biosur-
factant solutions” and “Bacterial strains” are
statistically significant with a P-value= 0,046.
Bonferroni test revealed significant differences
between the means obtained with Bs1 and Bs2
for all the strains (P-value= 0.021). The test
demonstrated significant differences between
the means of UFAB25 with the means of
UBA29 and UFAB19 (Fig. 2).
DISCUSSION
The nine native strains used in the study
were isolated in previous studies from different
environments, such as oil-contaminated soils
and hydrothermal springs with high mineral
concentrations. Bodour et al. (2003) mention
that a small fraction of the microbial commu-
nity is able to produce biosurfactants unless
there is selective pressure. The production
of biosurfactants is an important tool for the
survival of producing microorganisms, as it
increases the bioavailability of hydrocarbons
used as a carbon source (Zang et al., 2021) and
TABLE 5
Average values of the diameter of the clear zones in the oil displacement test
Culture medium Strains Diameter (mm) SD
Medium protocol 1 UFAB25 18.667 ± 1.155
UFAB29 26.333 ± 1.528
UFAB19 5.667 ± 1.155
Medium protocol 2 UFAB25 8.333 ± 1.527
UFAB29 10.333 ± 0.577
UFAB19 14.666 ± 2.309
SD: standard deviation.
Fig. 1. Agar- well diffusion method using F. oxysporum as a test microorganism. Left plate: UFAB25 biosurfactant extracts,
center plate: UFAB29. right plate: UFAB19. Well A. contains 50 µL of Bs1, B. 50 µL FBs1, C. 50 µL of Bs2, and D. 50 µl
of methanol (control).
642 Revista de Biología Tropical, ISSN: 2215-2075 Vol. 70: 636-646, e49716, Enero-Diciembre 2022 (Publicado Set. 09, 2022)
it acts as a chelating agent, forming insoluble
precipitates of toxic heavy metals (Saranya et
al., 2015). That is why soils contaminated with
organic substances or metals present a higher
percentage of surfactant-producing microor-
ganisms, due to selection pressure. Native
strains isolated from soils are valued as biopes-
ticides producers or as biocontrollers based on
the long-lasting effect of the biosurfactants as
well as the high environmental adaptability of
microorganisms in the soil.
Hemolytic activity has been widely used
as a qualitative and inexpensive method of bio-
surfactant production (Mulligan et al., 1984).
In the current study strains of B. subtilis, B.
cerus, B. toyanensis and B. megaterium were
positive for hemolytic activity. Hemolysis gen-
erated by B. subtilis has been widely reported
since Bernheimer & Avigad (1970) verified
the lysis of red blood cells due to the pres-
ence of surfactin. B. megaterium is generally
reported as non-hemolytic (Hsieh et al. 2004).
However, Thavasi et al. (2008) reported a strain
of B. megaterium that produces glycolipic
biosurfactants, with hemolytic activity. Some
strains of B. cereus produce lipopeptides, such
as mycocerein (Soberón-Chávez, 2011) and
fengicin (Ogena & Jacques, 2008). Nonethe-
less, the hemolytic capacity may not only be
due to the production of biosurfactants but
also to the presence of BL hemolysin, a widely
reported exotoxin in B. cereus (Beecher et al.,
1995). Youssef et al. (2004) mention that the
hemolytic test has excluded good producers of
biosurfactants, therefore, the rest of the strains
cannot be definitively ruled out as biosurfac-
tant producers.
Based on the identification of the genes
encoding for antimicrobial lipopeptides, it is
possible to study the relationship between their
products and biological activity. The isolation
and identification of novel antimicrobial-pro-
ducing Bacillus strains is a promising area of
research (Farzand et al., 2019). However, con-
ventional screening methods, in large groups of
microorganisms isolated from natural sources,
based on their direct antifungal activity are
laborious and time-consuming. That is why
the use of molecular markers is crucial for the
detection of genes in the selection of potential
biological controllers (Athukorala et al., 2009;
Farzard et al. 2019).
Fig. 2. Bar graph of mycelial growth inhibition results obtained with different biosurfactants solutions. The graph shows the
differences between the inhibition actions of the biosurfactans solutions obtained with the tree strains. There is a significance
difference (P-value: 0.024) between the results obtained with Bs1 and Bs2 produced with UFAB25.
643
Revista de Biología Tropical, ISSN: 2215-2075, Vol. 70: 636-646, e49716, Enero-Diciembre 2022 (Publicado Set. 09, 2022)
During the molecular screening, all the
strains of B. licheniformis presented the Lich-
AA gene, involved in the synthesis of licheny-
sin. Madslien et al. (2013) determined that the
vast majority of B. licheniformes strains pos-
sess this gene, indicating that a large proportion
are capable of producing it. Lichenysin can be
used as a surfactant agent in metal extraction,
bioremediation processes, textile, paper, and
food industries, and as a biofilms controller
of pathogenic organisms (Coronel-León et al.,
2015a; Coronel-Leon et al., 2015b).
UFAB25 (B. subtilis) was positive for sfp
and srfAA genes associated with surfactin pro-
duction, as well as for the fenB gene involved
in fengicin biosynthesis. The discovery of
strains capable of producing fengicin and sur-
factin has been widely documented in members
of the species B. subtilis (Ongena et al. 2007;
Płaza et al., 2015), even the co-production
of surfactin, fengicin, and iturin A, has been
reported, although it is very unusual (Kim et
al., 2004). The biosurfactant extract produced
by UFAB25 inhibited the mycelial growth of
F. oxysporum in a percentage of 43.6 ± 13.
The potential of B. subtilis biosurfactants to
combat several species of the genus Fusarium
has been previously reported (Mnif et al., 2015;
Ramarathnam et al., 2007). Mnif et al. (2015)
indicate that the inhibition of the phytopatho-
gen is due to the lysis of the excess mycelium,
polynucleation and destruction of the spores
by lipopeptides. Among the metabolites pro-
duced by B. subtilis with antifungal activity are
lipopeptides of the fengicin and iturin fami-
lies, while surfactins are attributed antibacte-
rial potential (Ongena & Jacques, 2008). These
compounds interact with the cell membranes
of phytopathogenic microorganisms generating
pores and an osmotic imbalance resulting in
cell death (Liu et al., 2014). The mechanism of
action of iturin is based on osmotic disturbance
due to the formation of conductive pores of
fungitoxic K+ ions. Surfactin causes rupture
and solubilization of membranes. Fengicin
alters the lipid bilayer of the cell membrane
structure and affects its permeability (Farzand
et al., 2019; Ongena, & Jacques, 2008). The
co-production of lipopeptides is able to gener-
ate synergistic effects on their biological activi-
ties (Perez et al., 2017).
The UFAB29 strain reported as B. subti-
lis only presented the genetic markers associ-
ated with surfactin and showed no relevant
inhibition against the phytopathogenic fungus.
According to Peypoux et al. (1999) surfactin
by itself is not antifungal, so the null action
presented could be understood. Perez et al.
(2017) reported the strain Bacillus sp. C3, posi-
tive for the sfp gene, had practically no action
against F. oxysporum. Similarly, Farzand et al.
(2019) determined that the B. subtilis OKB105
strain, positive for surfactin, was ineffective in
inhibiting the mycelial growth of filamentous
fungi. However, the biosurfactant produced by
UFAB29 with the first protocol has a crude oil
dispersion diameter of 26.3 mm, the diameter
of the dispersal zone correlates with the ability
of samples to reduce surface tension (Mori-
kawa et al., 2000). Therefore, it could present
other potential uses such as the environmental
remediation of hydrocarbons.
The only strain that exhibited strong anti-
fungal activity was USFA25 and it was the only
strain tested that had genes for fengicin synthe-
sis (fenB). While USFA29, which had srf-AA
and sfp genes, had much weaker antifungal
activity. These data support that fengicin is the
main antifungal agent.
Youssef et al. (2004) mention that oil dis-
persion test is a reliable method to detect the
production of surfactants. This technique is a
fast and inexpensive way to directly measure
the surface activity of the biosurfactants pres-
ent in the cell-free medium (Morikawa et al.,
2000). Different measures were obtained for the
same strain in different production mediums. It
is established that the profile (concentration
and/or type) of biosurfactants synthesized by
the same strain varies according to the medium
used, considering that the diameter of the clear
area on the surface of the crude oil is related to
the concentration and type of biosurfactant in
the solution (Youssef et al., 2004)
Differences were observed in the antifun-
gal activity of the lipopeptides synthesized by
644 Revista de Biología Tropical, ISSN: 2215-2075 Vol. 70: 636-646, e49716, Enero-Diciembre 2022 (Publicado Set. 09, 2022)
the UFAB25 strain in different culture media,
as well as the results obtained from the crude
dispersion test, the influence of the culture con-
ditions is suggested in the biosurfactant profile.
Coronel-León et al. (2015a) mention that the
nature of the carbon source, the concentra-
tion of salts in the medium, and the operating
conditions, such as temperature, agitation, and
dissolved oxygen are involved in the nature and
quantity of biosurtants synthesized.
The native strains isolated from contami-
nated soils, for instance strain UFAB25, posi-
tive for the genes involved in the production of
surfactin and fengycin, produced biosurfactants
that inhibited the mycelial growth of F. oxy-
sporum. UFAB25 was positive for hemolytic
activity and for crude oil dispersion test. The
detection of more than one molecular marker
involved in the biosynthesis of different lipo-
peptides with rapid, simple and economic tests
as crude oil dispersion and hemolytic activity
help to preselect potential bio-controllers. The
antifungal activities of the lipopeptides synthe-
sized by the UFAB25 strain in the two culture
mediums were different, due to the influence
of the culture conditions on the profile of the
biosurfactant produced.
Ethical statement: the authors declare
that they all agree with this publication and
made significant contributions; that there is no
conflict of interest of any kind; and that we fol-
lowed all pertinent ethical and legal procedures
and requirements. All financial sources are
fully and clearly stated in the acknowledge-
ments section. A signed document has been
filed in the journal archives.
ACKNOWLEDGMENTS
This study was developed with research
funds from CEDIA (Corporación Ecuatoriana
para el Desarrollo de la Investigación y la
Academia) by project CEPRA XIII-2019-07
“Formulación de biosanitizantes a partir de
tensioactivos microbianos para su aplicación
en la industria de alimentos” and Universidad
de las Fuerzas Armadas – ESPE. We thank
the support of the Center of Nanoscience and
Nanotechnology (CENCINAT). We are very
grateful to Rachid Seqqat, Theofilos Toulkeri-
dis, Carolina Molina and Fernanda Toscano for
the significant improvement in the English of
the manuscript.
RESUMEN
Potencial antifúngico de biosulfactantes producidos
por cepas de Bacillus spp. (Bacillales: Bacillaceae)
seleccionadas por tamizaje molecular
Introducción: Especies de Bacillus han sido empleadas
como controladores biológicos contra hongos fitopatóge-
nos. Entre los mecanismos utilizados se destaca la bio-
síntesis de biosurfactantes lipopeptídicos con actividad
antifúngica.
Objetivo: Evaluar el potencial antifúngico de los biosur-
factantes producidos por cepas Bacillus nativas, previa-
mente seleccionadas mediante tamizaje molecular, sobre
Fusarium oxysporum.
Métodos: Se utilizaron cuatro marcadores moleculares,
relacionados con la biosíntesis de surfactina, fengicina y
liquenisina (srfA, spf, fenB, LichAA) sobre nueve cepas de
Bacillus. Se utilizaron dos medios minerales con diferentes
condiciones de cultivo para la producción del biosurfactan-
te. Se evaluó el potencial antifúngico de los biosurfactantes
mediante la prueba de difusión en pozos.
Resultados: Se determinó que solo el biosurfactante pro-
ducido por UFAB25 actúa como inhibidor del crecimiento
micelial de Fusarium oxysporum (43.6 % ± 13), esta cepa
es positiva para los genes srfA, spf y fenB, involucrados en
la síntesis de surfactina y fengicina. La actividad antifúngi-
ca depende de las condiciones de cultivo y la cepa.
Conclusiones: Los marcadores genéticos ayudan a detectar
cepas con potencial antifúngico, facilitando la selección de
biocontroladores. El perfil del biosurfactante está influen-
ciado no solo por la cepa, sino también por las condiciones
del cultivo.
Palabras claves: surfactantes microbianos; cepas nati-
vas; Bacillus subtilis; actividad antifúngica; marcador
molecular.
REFERENCES
Athukorala, S. N., Fernando, W. G., & Rashid, K. Y. (2009).
Identification of antifungal antibiotics of Bacillus
species isolated from different microhabitats using
polymerase chain reaction and MALDI-TOF mass
spectrometry. Canadian Journal of Microbiology,
55(9), 1021–1032.
645
Revista de Biología Tropical, ISSN: 2215-2075, Vol. 70: 636-646, e49716, Enero-Diciembre 2022 (Publicado Set. 09, 2022)
Beecher, D. J., Schoeni, J. L., & Wong, A. C. (1995).
Enterotoxic activity of hemolysin BL from Bacillus
cereus. Infection and Immunity, 63(11), 4423–4428.
Ben-Dov, E., Zaritsky, A., Dahan, E., Barak, Z., Sinai,
R., Manasherob, R., Khamraev, A., Troitskaya, E.,
Dubitsky, A., Berezina, N., & Margalith, Y. (1997).
Extended screening by PCR for seven cry-group
genes from field-collected strains of Bacillus thurin-
giensis. Applied and Environmental Microbiology,
63(12), 4883–4890.
Bernheimer, A. W., Avigad, L. S. (1970) Nature and proper-
ties of a cytolytic agent produced by Bacillus subtilis.
Journal of General Microbiology, 61, 361–369.
Bodour, A. A., Drees, K. P., & Maier, R. M. (2003). Distri-
bution of biosurfactant-producing bacteria in undis-
turbed and contaminated arid southwestern soils.
Applied and Environmental Microbiology, 69(6),
3280–3287.
Borriss, R. (2011). Use of plant-associated Bacillus stra-
ins as biofertilizers and biocontrol agents in agri-
culture. In D. K. Maheshwari (Ed.), Bacteria in
Agrobiology: Plant Growth Responses (pp. 41–76).
Springer-Verlag.
Chan, E. Y. (2005). Advances in sequencing technology.
Mutation Research, 573(1-2), 13–40.
Chowdhury, S. P., Hartmann, A., Gao, X., & Borriss, R.
(2015). Biocontrol mechanism by root-associated
Bacillus amyloliquefaciens FZB42 - a review. Fron-
tiers in Microbiology, 6, 780.
Chung, S., Kong, H., Buyer, J. S., Lakshman, D. K., Lydon,
J., Kim, S., & Roberts, D. P. (2008). Isolation and
partial characterization of Bacillus subtilis ME488
for suppression of soilborne pathogens of cucumber
and pepper. Applied Microbiology and Biotechnolo-
gy, 80(1), 115–123.
Coronel-León, J., Grau, G. D., Grau-Campistany, A., Far-
fan, M., Rabanal, F., Manresa, A., & Marqués, A.
M. (2015a). Biosurfactant production by AL 1.1, a
Bacillus licheniformis strain isolated from Antarctica:
production, chemical characterization and properties.
Annals of Microbiology, 65(4), 2065–2078.
Coronel-León, J., Marqués, A., Bastida, J., & Manresa, A.
(2015b). Optimizing the production of the biosurfac-
tant lichenysin and its application in biofilm control.
Journal of Applied Microbiology, 120(1), 99–111.
El-Sheshtawy, H., Aiad, I., Osman, M., Abo-Elnasr, A., &
Kobisy, A. (2015). Production of biosurfactant from
Bacillus licheniformis for microbial enhanced oil
recovery and inhibition the growth of sulfate redu-
cing bacteria. Egyptian Journal of Petroleum, 24(2),
155–162.
Farzand, A., Moosa, A., Zubair, M., Khan, A. R., Hanif,
A., Tahir, H. A., & Gao, X. (2019). Marker assisted
detection and LC-MS analysis of antimicrobial com-
pounds in different Bacillus strains and their anti-
fungal effect on Sclerotinia sclerotiorum. Biological
Control, 133, 91–102.
Freire, J., & Sato, M. (1999). Conservación de cultivos de
rizobios. Revista Latinoamericana de Microbiología,
41, 35–41.
Ghribi, D., & Ellouze-Chaabouni, S. (2011). Enhancement
of Bacillus subtilis lipopeptide biosurfactants pro-
duction through optimization of medium composition
and adequate control of aeration. Biotechnology
Research International, 2011, 1–6.
Horikoshi, K. (2007). Past, present and future of extremo-
philes. Extremophiles, 12(1), 1–2.
Hsieh, F., Li, M., Lin, T., & Kao, S. (2004). Rapid detection
and Characterization of Surfactin-Producing Bacillus
subtilis and Closely Related Species Based on PCR.
Current Microbiology, 49(3), 186–191.
Jarrín, F. (2010). Protocolo de extracción de ADN de
bacterias y hongos CTAB-Modificación del Centro
Internacional de la PAPA. In A. Carrera, C. Yánez, &
E. Morillo (Eds.), Uso y conservación de la biodiver-
sidad de cepas de Azospirillum spp. para la produc-
ción y validación de un biofertilizante para el cultivo
de maíz en la Sierra del Ecuador (pp. 32). Instituto de
Investigaciones Agropecuarias (INIAP).
Kim, P., Bai, H., Bai, D., Chae, H., Chung, S., Kim, Y.,
Park, R., & Chi, Y. T. (2004). Purification and cha-
racterization of a lipopeptide produced by Bacillus
thuringiensis CMB26. Journal of Applied Microbio-
logy, 97(5), 942–949.
Litsinger, J. A. (1989). Second generation insect pest pro-
blems on high yielding rices. Tropical Pest Manage-
ment, 35(3), 235–242.
Liu, J., Hagberg, I., Novitsky, L., Hadj-Moussa, H., & Avis,
T. J. (2014). Interaction of antimicrobial cyclic lipo-
peptides from Bacillus subtilis influences their effect
on spore germination and membrane permeability
in fungal plant pathogens. Fungal Biology, 118(11),
855–861.
Li, Y., Yang, S., & Mu, B. (2010). The surfactin and
lichenysin isoforms produced by Bacillus lichenifor-
mis HSN 221. Analytical Letters, 43(6), 929–940.
Madslien, E., Rønning, H., Lindbäck, T., Hassel, B.,
Andersson, M., & Granum, P. (2013). Lichenysin
is produced by most Bacillus licheniformis strains.
Journal of Applied Microbiology, 115, 1068–1080.
Mahmood, I., Imadi, S. R., Shazadi, K., Gul, A., & Hakeem,
K. R. (2016). Effects of pesticides on environment. In
K. Hakeem, M. Akhtar, & S. Abdullah (Eds.), Plant,
soil and microbes (pp. 253–269). Springer.
646 Revista de Biología Tropical, ISSN: 2215-2075 Vol. 70: 636-646, e49716, Enero-Diciembre 2022 (Publicado Set. 09, 2022)
Mnif, I., Grau-Campistany, A., Coronel-León, J., Hamma-
mi, I., Triki, M. A., Manresa, A., & Ghribi, D. (2015).
Purification and identification of Bacillus subtilis
SPB1 lipopeptide biosurfactant exhibiting antifungal
activity against Rhizoctonia bataticola and Rhizoc-
tonia solani. Environmental Science and Pollution
Research, 23(7), 6690–6699. https://doi.org/10.1007/
s11356-015-5826-3
Mnif, I., Sahnoun, R., Ellouze-Chaabouni, S., & Ghribi,
D. (2013). Evaluation of B. subtilis SPB1 biosurfac-
tants’ potency for diesel-contaminated soil washing:
Optimization of oil desorption using Taguchi design.
Environmental Science and Pollution Research,
21(2), 851–861.
Morikawa, M., Hirata, Y., & Imanaka, T. (2000). A study
on the structure–function relationship of lipopeptide
biosurfactants. Biochimica Et Biophysica Acta (BBA)
- Molecular and Cell Biology of Lipids, 1488(3),
211–218.
Mulligan, C., Cooper, D., & Neufeld, R. (1984). Selec-
tion of microbes producing biosurfactants in media
without hydrocarbons. Journal of Fermentation Tech-
nology, 62(4), 311–314.
Ongena, M., & Jacques, P. (2008). Bacillus lipopeptides:
Versatile weapons for plant disease biocontrol. Trends
in Microbiology, 16(3), 115–125.
Ongena, M., Jacques, P., Touré, Y., Destain, J., Jabrane, A.,
& Thonart, P. (2005). Involvement of fengycin-type
lipopeptides in the multifaceted biocontrol potential
of Bacillus subtilis. Applied Microbiology and Biote-
chnology, 69(1), 29–38.
Ongena, M., Jourdan, E., Adam, A., Paquot, M., Brans, A.,
Joris, B., Arpigny, J. L., & Thonart, P. (2007). Sur-
factin and fengycin lipopeptides of Bacillus subtilis
as elicitors of induced systemic resistance in plants.
Environmental Microbiology, 9(4), 1084–1090.
OriginLab. (2018). OriginPro (Version 2018). OriginLab
Corporation, Northampton, MA, USA.
Perez, K. J., Viana, J. D., Lopes, F. C., Pereira, J. Q., San-
tos, D. M., Oliveira, J. S., Velho, D. M., Crispim, S.,
Nicoli, J. R., Brandelli, A., & Nardi, R. M. (2017).
Bacillus spp. Isolated from Puba as a Source of Bio-
surfactants and Antimicrobial Lipopeptides. Frontiers
in Microbiology, 8, 61.
Peypoux, F., Bonmatin, J. M., & Wallach, J. (1999). Recent
trends in the biochemistry of surfactin. Applied
Microbiology and Biotechnology, 51(5), 553–563.
Płaza, G., Chojniak, J., Rudnicka, K., Paraszkiewicz, K.,
& Bernat, P. (2015). Detection of biosurfactants in
Bacillus species: genes and products identification.
Journal of Applied Microbiology, 119(4), 1023–1034.
Rajmohan, K. S., Chandrasekaran, R., & Varjani, S. (2020).
A review on occurrence of pesticides in environment
and current technologies for their remediation and
management. Indian Journal of Microbiology, 60(2),
125–138.
Ramarathnam, R., Bo, S., Chen, Y., Fernando, W. D.,
Xuewen, G., & Kievit, T. D. (2007). Molecular and
biochemical detection of fengycin- and bacillomycin
D-producing Bacillus spp., antagonistic to fungal
pathogens of canola and wheat. Canadian Journal of
Microbiology, 53(7), 901–911.
Sambrook, J., & Russell, D. W. (2001). Molecular clo-
ning: A laboratory manual. Cold Spring Harbor
Laboratory.
Saranya, P., Bhavani, P., Swarnalatha, S., & Sekaran, G.
(2015). Biosequestration of chromium (iii) in an
aqueous solution using cationic and anionic bio-
surfactants produced from two different Bacillus
sp. - a comparative study. RSC Advances, 5(98),
80596–80611.
Sherry, S. T., Ward, M. H., Kholodov, M., Baker, J., Phan,
L., Smigielski, E. M., & Sirotkin, K. (2001). dbSNP:
the NCBI database of genetic variation. Nucleic Acids
Research, 29(1), 308–311.
Soberón-Chavez, G. (2011). Biosurfactants: From genes to
applications. Springer.
St, L., & Wold, S. (1989). Analysis of variance (ANOVA).
Chemometrics and Intelligent Laboratory Systems,
6(4), 259–272.
Thavasi, R., Jayalakshmi, S., Balasubramanian, T., &
Banat, I. M. (2008). Production and characterization
of a glycolipid biosurfactant from Bacillus mega-
terium using economically cheaper sources. World
Journal of Microbiology and Biotechnology, 24(7),
917–925.
Wilson, C., & Tisdell, C. (2001). Why farmers continue
to use pesticides despite environmental, health and
sustainability costs. Ecological Economics, 39(3),
449–462.
Youssef, N. H., Duncan, K. E., Nagle, D. P., Savage, K. N.,
Knapp, R. M., & Mcinerney, M. J. (2004). Compari-
son of methods to detect biosurfactant production by
diverse microorganisms. Journal of Microbiological
Methods, 56(3), 339–347.
Zang, T., Wu, H., Yan, B., Zhang, Y., & Wei, C. (2021).
Enhancement of PAHs biodegradation in biosurfac-
tant/phenol system by increasing the bioavailability
of PAHs. Chemosphere, 266, 128941.
