Revista de Biología Tropical, ISSN: 2215-2075, Vol. 73: e00000, enero-diciembre 2025 (Publicado Abr. 28, 2025)

Mitochondrial sequencing to guide the management

of endangered turtles in Colombia

Luis Alejandro Arias-Sosa1, 2,*; https://orcid.org/0000-0002-6239-9809

Karen Giselle Rodríguez-Castro3; https://orcid.org/0000-0002-0333-6402

María Helena Agudelo-González3; https://orcid.org/0000-0002-5392-3162

Brayhan Ramos-Villalba3; https://orcid.org/0009-0000-7916-5462

Sebastián Cuadrado-Ríos1; https://orcid.org/0000-0002-1060-820X

Claudia Brieva4; https://orcid.org/0000-0003-3630-1318

Carlos Miguel del Valle-Useche5; https://orcid.org/0000-0003-1973-0444

Maria Camila Balcero-Deaquiz1; https://orcid.org/0000-0002-8439-7345

Mario Vargas-Ramírez1, 6*; https://orcid.org/000-0001-8974-3430

1. Grupo Biodiversidad y Conservación Genética, Instituto de Genética, Universidad Nacional de Colombia, Bogotá,

Colombia; luariass@unal.edu.co (*Correspondence), scuadrado@unal.edu.co, mcbalcerod@unal.edu.co, maavar-

gasra@unal.edu.co (*Correspondence)

2. Grupo Ecología de Organismos (GEO-UPTC), Escuela de Ciencias Biológicas, Universidad Pedagógica y Tecnológica

de Colombia, Tunja, Colombia.

3. Centro de Recursos Genéticos. Facultad de Ciencias Básicas e Ingeniería, Universidad de los Llanos, Villavicencio,

Colombia; karen.giselle.rodriguez@unillanos.edu.co; maria.helena.agudelo@unillanos.edu.co; brayhan.ramos@unil-

lanos.edu.co

4. Facultad de Medicina Veterinaria y de Zootecnia, Universidad Nacional de Colombia, Bogotá, Colombia; cibrievar@

unal.edu.co

5. Laboratorio de identificación genética forense de especies silvestres, Dirección de Investigación Criminal e Interpol

(DIJIN), Bogotá, Colombia; carlos.del3957@correo.policia.gov.co

6. Estación de Biología Tropical Roberto Franco (EBTRF), Universidad Nacional de Colombia, Villavicencio, Colombia.

Received 24-VI-2024. Corrected 18-X-2024. Accepted 10-IV-2025.

ABSTRACT

Introduction: Turtles are extensively harvested to supply the demand for food, pets, and products. Conservation

strategies often involve the release of seized individuals and ex-situ breeding programs. However, several traded

species have particular genetic characteristics, and the origins of captive individuals are often unknown. Despite

their potential to aid in the recovery of populations, these strategies have faced criticism due to the risk of out-

breeding depression and genetic diversity loss.

Objective: To explore the use of mitochondrial sequencing to estimate the origin of captive individuals from

three of Colombia’s most traded turtle species: Chelonoidis carbonarius, Trachemys venusta callirostris, and

Rhinoclemmys melanosterna.

Methods: Firstly, we constructed genetic reference databases using 350 sequences from previous phylogeograph-

ic studies and new ones from individuals with known origins. Secondly, through phylogenetic and population

genetics analyses we delimited phylogeographic groups. Thirdly, we compared the sequences of 157 turtles of

unknown origins, successfully assigning them to their species and the most likely areas of origin.

https://doi.org/10.15517/rev.biol.trop..v73i1.60604

CONSERVATION

2Revista de Biología Tropical, ISSN: 2215-2075 Vol. 73: e00000, enero-diciembre 2025 (Publicado Abr. 28, 2025)

INTRODUCTION

Illegal trade emerges as a prominent driver

of global biodiversity loss in vertebrates, affect-

ing approximately 5 579 species, including

around 1 147 reptiles primarily traded as pets

and products (Scheffers et al., 2019). Recent

estimates revealed that a staggering 421 mil-

lion wildlife individuals listed under CITES

fell victim to global trafficking between 1998

and 2018, with a disproportionately severe

impact on developing nations facing economic

challenges (Liew et al., 2021). This illicit trade

generates significant revenue, around $ 3.2

billion annually in the U.S., fueling criminal

organizations and threatens both biodiversity

and global biosecurity (Rosen & Smith, 2010;

Tow et al., 2021).

Turtles (order Testudines) are significantly

impacted by illegal trade, resulting in substan-

tial reductions in their populations, with 51 %

of species classified as threatened (Böhm et al.,

2013; Lin et al., 2021). The primary contribu-

tors to this decline include habitat degradation,

as well as overexploitation for food, pets, and

traditional medicine (Stanford et al., 2020).

Concerningly, for marine turtles, an estimated

44 000 individuals are traded anually (Senko

et al., 2022). However, studies in species like

the hawksbill sea turtles (Eretmochelys imbri-

cata) suggest that this figure may be underesti-

mated (Miller et al., 2019). The illegal trade of

Results: We identified genetic structure in wild populations, heterogeneity of origins in captive individuals,

and complex trade networks involving harvesting from multiple distant poaching areas and transportation to

central regions.

Conclusions: This study shows the efficacy of mitochondrial molecular markers in determining the possible

region of origin for confiscated turtle individuals affected by illegal trade and emphasizes the importance of intra-

specific conservation efforts to safeguard Colombian wildlife’s genetic identity and diversity.

Keywords: genetic structure; haplotype diversity; illegal trade; phylogeography; Testudines.

RESUMEN

Secuenciación mitocondrial para guiar el manejo de tortugas en peligro de extinción en Colombia

Introducción: Las tortugas son ampliamente cosechadas para suplir demandas de alimento, mascotas y pro-

ductos. Las estrategias de conservación a menudo implican la liberación de individuos incautados y programas

de cría ex-situ. Sin embargo, varias especies comercializadas muestran características genéticas particulares y el

origen de los individuos en cautiverio se desconoce. A pesar de su potencial para ayudar en la recuperación de

poblaciones en declive, estas estrategias han enfrentado críticas debido al riesgo de depresión exogámica y pérdida

de diversidad genética.

Objetivo: Explorar el uso la secuenciación mitocondrial para estimar el origen de individuos cautivos pertene-

cientes a tres de las especies de tortugas más comercializadas en Colombia: Chelonoidis carbonarius, Trachemys

venusta callirostris y Rhinoclemmys melanosterna.

Métodos: Primero, construimos bases de datos genéticas de referencia utilizando 350 secuencias de estudios filo-

geográficos anteriores y muestras nuevas de individuos con orígenes conocidos. Segundo, mediante análisis filo-

genéticos, y de genética de poblaciones, delimitamos grupos filogeográficos. Tercero, comparamos las secuencias

de 157 tortugas de origen desconocido, asignándolas con éxito a su especie y las áreas de origen más probables.

Resultados: Identificamos estructura genética en poblaciones silvestres, heterogeneidad de orígenes en indivi-

duos en cautiverio y redes comerciales complejas que implican la cosecha en múltiples áreas de caza distantes y

el transporte a regiones centrales.

Conclusiones: Este estudio muestra la eficacia de los marcadores moleculares mitocondriales para determinar

la posible región de origen de individuos de tortugas confiscadas afectadas por el comercio ilegal y enfatiza la

importancia de los esfuerzos de conservación intraespecíficos para salvaguardar la identidad y la diversidad

genética de la vida silvestre colombiana.

Palabras clave: estructura genética; diversidad de haplotipos; comercio ilegal; filogeografía; Testudines.

Revista de Biología Tropical, ISSN: 2215-2075, Vol. 73: e00000, enero-diciembre 2025 (Publicado Abr. 28, 2025)

continental turtles is also pervasive, exempli-

fied by the Indian Star Tortoises (Geochelone

elegans), with records from a single “trade hub”

in India of approximately 50 000 individu-

als over 40 years (D’Cruze et al., 2015). This

widespread trade not only poses a significant

threat to wild populations but also increases

the potential risk of zoonotic disease outbreaks,

as seen in cases of salmonellosis linked to pet

turtles (Montague et al., 2022).

Colombia is home of 33 turtle species;

however, a concerning 37 % of them fall under

a conservation threat category (Morales-Betan-

court et al., 2015). This problem is significantly

driven by illegal trade, as turtles are extensively

exploited for their meat and eggs, kept as pets,

used in traditional medicine, and their parts are

utilized in handicrafts (Sollund, 2017). Among

the 28 species of tortoises and freshwater tur-

tles, 23 are exploited by local communities,

and 25 are illegally traded (Páez et al., 2012),

Particularly impacting the genera Chelonoidis,

Trachemys, Kinosternon, Podocnemis, and Rhi-

noclemmys (Arroyave-Bermudez et al., 2014;

Bernal-Restrepo, 2021).

The Colombian slider turtle (Trachemys

venusta callirostris) is the most traded turtle

in the country with over a million individuals

extracted annually from just one locality (Bock

et al., 2015; Mendivelso-Gamboa & Montene-

gro, 2007). This turtle is classified as vulnerable

(VU), primarily attributed to overexploitation

of the population and habitat degradation (Bock

et al., 2015). The red-footed tortoise (Chelonoi-

dis carbonarius) ranks as the second-third most

traded turtle in Colombia and the foremost in

some central regions (Bernal-Restrepo, 2021;

Suárez-Giorgi, 2016). Nationally classified as

vulnerable (VU), its main threats include the

illegal pet trade, driven by the belief that its

possession brings good luck, and to a lesser

extent, its meat consumption (Medina-Rangel,

2015). Rhinoclemmys turtles constitute the fifth

most traded genus in the country, with species

like the Colombian wood turtle (Rhinoclem-

mys melanosterna) and the Maracaibo wood

turtle (Rhinoclemmys diademata) classified as

Near Threatened (NT) and Endangered (EN),

respectively (Morales-Betancourt et al., 2015;

Arroyave-Bermudez et al., 2014). These turtles

are hunted in their natural habitats for food

consumption in various localities, as pets, and

to produce handicrafts made with their shells

(Echeverri-García et al., 2012).

The extensive extraction and subsequent

seizure of turtles demand an adequate man-

agement of captive individuals. Information

regarding the Colombian slider turtle reveals

that approximately 70 % of seized turtles exhibit

at least one clinical problem, with a significant

56 % succumbing during the rehabilitation

process (Castro-Cortés et al., 2022). For suc-

cessfully rehabilitated individuals, the opti-

mal goal is their release back into the wild.

However, the complex trade networks, which

link international markets and extraction of

turtles from remote regions to supply areas with

high demand, complicates identifying their

geographic origins (Arroyave-Bermudez et al.,

2014). As a result, current protocols release

seized individuals without distinguishing their

original populations, placing them in general

areas within the species’ distribution range.

To contribute to the conservation of turtles

in Colombia, ex-situ conservation projects have

been proposed, aiming at establishing hatchery

programs (Morales-Betancourt et al., 2015).

This vital conservation strategy for turtles aims

to strengthen wild populations, while preserv-

ing their genetic diversity, and has been proven

effective in recovering populations at risk of

extinction (Barbanti et al., 2019; Martins et al.,

2021). However, in some of the breeding stocks

used in reptiles ex-situ conservation in Colom-

bia, precise information regarding their origin

and genetic background is lacking, limiting the

implementation of these conservation strategies

(Saldarriaga-Gómez et al., 2023).

Several turtle species in the country exhib-

it intraspecific phylogeographic patterns with

individuals from different geographic locations

representing distinct genetic or evolutionary

lineages (Gallego-García et al., 2023; Vargas-

Ramírez et al., 2013). Therefore, translocating

individuals without knowledge of their geo-

graphic origin can lead to unwanted outcomes,

4Revista de Biología Tropical, ISSN: 2215-2075 Vol. 73: e00000, enero-diciembre 2025 (Publicado Abr. 28, 2025)

as mixing populations from distant genetic

clusters risks homogenizing natural genetic

diversity, outbreeding depression, and reduc-

tion of the offspring fitness (Frankham et al.,

2011; Gippoliti et al., 2018; Oklander et al.,

2020). Reports of potential outbreeding depres-

sion have surfaced in cases of hybridization

between sea turtle species, resulting in reduced

reproductive success (Arantes et al., 2020).

Furthermore, a preliminary and tentative study

identified inbreeding–outbreeding tension in

hawksbill turtle populations (Phillips et al.,

2017). Recognizing that this risk is crucial in

the conservation programs for turtle popula-

tions, the identification of geographic origin for

translocation and release scenarios is manda-

tory (Alacs et al., 2007).

In cases where precise geographic origin

information is unavailable, the use of tools

such as genetic markers has been proposed

to address this limitation (Oklander et al.,

2020). This approach employing mitochondrial

markers has proven effective in determining

the geographic origin of Seized individuals

and products in turtles as the Hawksbill turtle

(Eretmochelys imbricata) in Asia and Austra-

lia (LaCasella et al., 2021), the Star tortoises

(Geochelone elegans) in Singapore (Gaur et al.,

2006), and the Sea turtle (Chelonia mydas) in

China, (Gaillard et al., 2021). Additionally, this

strategy has proven efficient in determining the

origin of captive individuals in Colombia, such

as the Orinoco matamata turtle (Chelus ori-

nocensis) (Lasso et al., 2018), and the savanna

side-necked turtle (Podocnemis vogli) (Cárde-

nas-Barrantes et al., 2024). However, similar

studies are lacking for several highly trafficked

turtle species in the country.

In this study, we applied mitochondrial

sequencing to estimate the origins of captive

individuals from three of Colombia’s most traf-

ficked turtle species: Chelonoidis carbonarius,

Trachemys venusta callirostris, and Rhinoclem-

mys melanosterna. This approach aims to pro-

vide new tools to enhance release protocols,

mitigate potential negative impacts on wild

populations, and offer crucial insights into the

characterization of trade networks.

MATERIALS AND METHODS

Reference genetic databases: In this study,

we established a reference genetic database

integrating secondary information from previ-

ous studies and incorporating new sequences

obtained from tissue samples from individuals

with known origin. These new samples were

sourced from the Banco de ADN y Tejidos de

la Biodiversidad (BTBC), stored at the Instituto

de Genética, Universidad Nacional de Colom-

bia (SMT 1).

For the Red-footed tortoise (C. carbon-

arius), we used 27 published sequences of the

Cytochrome b (CYTB) gene from a previ-

ous study and sequenced 162 new samples

from previously unsampled localities. For the

Rhinoclemmys turtles, we employed 75 CYTB

sequences from an earlier study and added 28

tissue samples from individuals collected from

unsampled areas. For the Colombian slider

turtle (T. v. callirostris), we obtained 58 Control

Region (CR) sequences.

Sample collection from individuals of

unknown origin: Tissue samples lacking infor-

mation on geographic origin were obtained

from both seized individuals and breeding

stock turtles used in ex-situ conservation

efforts. The seized individuals were sourced

from the Wild Animal Rescue and Rehabilita-

tion Unit (URRAS for its acronym in Span-

ish) of the Universidad Nacional de Colombia

and the Wild Fauna Reception Center of the

Regional Autonomous Corporation of Cun-

dinamarca (CAR for its acronym in Spanish).

Simultaneously, samples from breeding stock

turtles were sourced from the Estación de

Biología Tropical Roberto Franco (EBTRF)

ex-situ research and conservation program at

the Universidad Nacional de Colombia in Vil-

lavicencio, Meta (SMT 1).

In the analysis of the Red-footed tortoise,

a total of 77 samples of unknown origin were

examined, comprising 73 from the URRAS-

CAR and four from the EBTRF. For the Colom-

bian wood turtle and Maracaibo wood turtle,

samples from 38 individuals were included,

Revista de Biología Tropical, ISSN: 2215-2075, Vol. 73: e00000, enero-diciembre 2025 (Publicado Abr. 28, 2025)

with 11 from the URRAS-CAR and 27 from the

EBTRF. Additionally, for the freshwater Colom-

bian slider turtle, 42 samples were collected,

consisting of 32 from the URRAS-CAR and 10

from the EBTRF.

DNA Extraction, PCR and sequencing:

Whole DNA was extracted from tissue samples

using the NucleoSpin Tissue Kit from MACH-

EREY-NAGEL, Germany, following the manu-

facturer’s instructions. DNA concentration and

purity levels (measured by 280-260 and 230-

260 ratios) were quantified with an EzDrop 1

000 Micro-Volume Spectrophotometer (Bleu-

Ray). For the amplification of a fragment rang-

ing from 719 to 723 bp of the CYTB gene for

C. carbonarius and Rhinoclemmys turtles, the

primers mt-c-For2 (TGAGG VCARATATCAT-

TYTGAG) and mt-f-na (GCRAATARRAAG-

TATCATTCTGG) (Fritz et al., 2006) were used.

A fragment of 638 bp for the CR gene of T. v.

callirostris was obtained using the primers Tca_

CRL (CCAGCTCCCAAAGCTGAGAT) and

Tca_CRH (GTGGCTATTCGGACTGGTGT)

(Balcero-Deaquiz, 2022). The PCR solution

consisted of 25 μl, with 30-100 ng of DNA

(0.5-5 μl), 12.5 μl of OneTaq® 2X Master Mix

with Standard Buffer (Biolabs), 1.25 μl of the

forward primer, 1.25 μl of the reverse primers,

and adjusted with ultrapure water. PCR reac-

tions were carried out using a Mastercycler

PRO S 6325 Thermal Cycler (Eppendorf). The

protocol included a denaturation step at 94

°C for 5 minutes, followed by 35-40 cycles of

denaturation at 94°C for 45 seconds, annealing

at 50-60 °C for 52 seconds, extension at 72 °C

for 80 seconds, and a final elongation cycle at

72 °C for 10 minutes. Amplification products

were verified using 1% agarose gel electropho-

resis stained with Z-vision. PCR products were

purified using the ammonium acetate protocol

of Bensch et al. (2 000). The purified products

were sequenced using Sanger sequencing tech-

nology with an ABI 3 130 sequencer (Applied

Biosystems).

Identification of phylogeographic

groups: To investigate whether the studied

species exhibit a phylogeographic structure

that allows for separation into geographical-

ly delimited genetic groups, we employed 1)

a phylogenetic approach using Bayesian and

Maximum Likelihood algorithms, and 2) hap-

lotype network reconstruction. Initially, we

aligned all sequences within each genetic refer-

ence database (comprising samples of known

geographic origin) using the MUSCLE func-

tion available in MEGA 11. The Bayesian spe-

cies tree was constructed using BEAST 2.6.7

and BEAUTI 2 software. The most appropri-

ate substitution model was determined using

JmodelTest 2.1.1 software based on the Bayes-

ian information criterion (BIC). Two Mar-

kov Chain Monte Carlo (MCMC) runs were

conducted separately. Each MCMC included

50000 000 generations with samples collected

every 1 000 generations. The results of both

MCMC runs were combined using LogCom-

biner 2, ensuring adequate sampling processes

and convergence. The maximum credibility

tree (20 % burn-in) and posterior probabili-

ties (PP) were obtained using TreeAnnotator

2.6.6. The maximum likelihood analysis was

performed using IQ-tree version 1.6.12, and

the optimal substitution model was assessed

using the ModelFinder function. A consensus

tree with bootstrap support (100 000 bootstrap

replicates) was obtained. The maximum cred-

ibility tree and consensus tree were visualized

and edited using FigTree 1.4.4 software.

For the haplotypes analisys, sequences

were collapsed into haplotypes using DnaSP

version 6.12.03. The Haplotype networks were

constructed and visualized in PopART version

1.7 utilizing the TCS algorithm (Cruz et al.,

2021). The relationship between haplotypes

and geographic origin was depicted on a hap-

lotype map, also created using PopART. To

achieve a more precise delimitation of genetic

groups, we employed the Bayesian Analysis

of Population Structure (BAPS) algorithm in

the R environment (RhierBAPS) using default

parameters (Tonkin-Hill et al., 2018).

Genetic distances and structure: For a

quantitative measure of the genetic differences

6Revista de Biología Tropical, ISSN: 2215-2075 Vol. 73: e00000, enero-diciembre 2025 (Publicado Abr. 28, 2025)

between phylogeographic/genetic groups, we

computed p-uncorrected genetic distances

using MEGA 11 software with 1 000 bootstrap

repetitions (Santos-Rodrigues et al., 2016). To

assess the statistical significance of differences

between the revealed evolutionary lineages, we

performed an analysis of molecular variance

(AMOVA) and differentiation coefficients (FST)

using the Arlequin 3.5.2.2 software.

Approximation of the probable geo-

graphic origin in captive individuals:

Sequences from both seized and breeding stock

parental individuals were jointly analyzed with

the genetic reference databases to determine

their most likely origin. These analyses were

based on the association of each seized indi-

vidual’s haplotype with the previously identi-

fied phylogroups (Gaur et al., 2006; LaCasella

et al., 2021). To provide further insight into

this association, we performed a repeat haplo-

type analysis in PopArt and RhierBAPS analy-

sis, incorporating samples from the captive

individuals.

RESULTS

Red-footed tortoise (Chelonoidis carbon-

arius): The phylogenetic analyses unveiled a

distinctive geographic pattern within this turtle

species. Initial separation is evident between

samples from the Cis-Andean region and those

from the Trans-Andean region in the North-

west of the continent (Fig. 1). Within the Cis-

Andean group, further subdivision is observed

between samples in the Southwest of Paraguay

(CH-PA) and those in the Northeast part of

South America. The latter group forms two

clades, comprising samples from the Eastern

region in French Guiana (CH-FG) and those

from the Orinoco Llanos of Colombia (CH-

OL). In the Trans-Andean group (CH-TA),

four subclades are discerned, although they do

not constitute monophyletic groups based on

geographic origins.

The haplotype network and RhierBAPS

analysis (Fig. 2A, Fig. 2C) further differentiate

the samples from Paraguay (CH-PA), French

Guiana (CH-FG), and the Orinoco Llanos (CH-

OL) as distinct genetic groups. Additionally,

the analysis subdivides the samples from the

Trans-Andean region into four separate groups.

While these clusters exhibit some geographic

separation, the presence of shared haplotypes

across biogeographic regions underscores the

complexity of genetic relationships. Despite the

absence of strict geographic correspondence,

notable phylogeographic patterns emerge with-

in these groups. The genetic group CH-TA1 is

predominantly found in the East Caribe savan-

nas and the middle Magdalena inter-Andean

Valleys. CH-TA2 is highly dominant in the

Guajira Peninsula in the Northwestern part of

Colombia. Haplotypes of CH-TA3 are more

frequent in the Sinú valleys. Lastly, CH-TA-4

is associated with a wide range of ecosystems

in the North to Northwest of the country,

encompassing the Magdalena River Basin, the

Sinú valleys, and the Northern Pacific plains.

Notably, samples from the Northwestern Pacific

plains exhibit multiple genetic group associa-

tions, with 40 % of them displaying a unique

haplotype (TA3-6).

To assess the significance of differences

between the studied regions (French Guyana,

Paraguay, Orinoco Llanos, Magdalena River

Basin, Middle Magdalena Inter-Andean Val-

leys, East Caribe savannas, Sinú Valleys, Pacific

Plains, and Guajira Peninsula), we conducted

an Analysis of Molecular Variance (AMOVA)

and an FST test. The analysis yielded a highly

significant value (p < 0.01), with 83 % of the

observed variance occurring between popula-

tions. Pairwise comparisons further confirmed

significant differences (p < 0.05) between all

regions, except for the Magdalena River Basin

vs. East Caribe savannas (p = 0.25) and the

Middle Magdalena valleys vs. East Caribe

savannas (p = 0.25). Consequently, the Mag-

dalena valleys and East Caribe savannas were

considered a single genetic group.

Genetic distances between French Guy-

ana, Paraguay, Orinoco Llanos, and Northern

groups ranged between 2-3 %, whereas the

distance within the Northern groups was much

lower, ranging from 0.06-0.2 % (SMT 2).

Revista de Biología Tropical, ISSN: 2215-2075, Vol. 73: e00000, enero-diciembre 2025 (Publicado Abr. 28, 2025)

Fig. 1. Bayesian inference tree of the CYTB gene for the Red-footed tortoise. The corresponding support values are shown as

posterior probability (PP) (left) and bootstrap support (right).

8Revista de Biología Tropical, ISSN: 2215-2075 Vol. 73: e00000, enero-diciembre 2025 (Publicado Abr. 28, 2025)

Given these findings, we evaluated the

utility of mitochondrial sequencing to esti-

mate the most probable origin in 73 turtles

rescued from illegal trade and four individuals

from the ex-situ conservation program of the

EBTRF (Fig. 2B). The analyses revealed that

two of the seized specimens were misidenti-

fied and corresponded to the yellow-footed

tortoise (Chelonoidis denticulata). Among the

seized individuals, 75 % (50) of the samples

were assigned to the Trans Andean group,

while only 25 % (17) were assigned to the

Cis-Andean Orinoco Llanos (Fig. 2B). Within

the Trans Andean region, there appeared to be a

higher impact on the Guajira Peninsula, as 27 %

(18) of the samples were assigned to CH-TA2.

Additionally, there was a significant impact on

the East Caribe Savannas and the Middle Mag-

dalena Inter-Andean Valleys, with 23 % (16)

assigned to CH-TA1. Conversely, the Western

ecosystems seemed to be less exploited, with

14 % (9) assigned to CH-TA3 (associated with

the North to Northwestern ecoregions) and

11 % (7) to CH-TA4. Within the CH-TA4

Fig. 2. A. Haplotype network of the Red-footed tortoise constructed using sequences of individuals with known geographic

origins. B. Haplotype network of Red-footed tortoise including sequences from seized individuals in Colombia. Hatch

marks indicate the number of mutations separating each haplotype. Colored boxes represent the haplotypes grouped under

a population according to RhierBAPS Analysis. C. Haplotype map plot for the Red-footed tortoise. The size of the circles

indicates the number of samples with a respective haplotype. In set photography of an adult female Chelonoidis carbonarius

from the EBTRF. Photo by Juan Manuel Vargas Ramírez.

Revista de Biología Tropical, ISSN: 2215-2075, Vol. 73: e00000, enero-diciembre 2025 (Publicado Abr. 28, 2025)

population (associated with the Sinú valleys),

one sample was associated with the haplotype

found exclusively in the Pacific plains (TA4-

17). Regarding the four samples from the ex-

situ conservation program, three of them were

assigned to the Orinoco Llanos clade, and one

to the CH-TA-2 group, most likely originating

from the Guajira Peninsula.

Colombian wood turtle (Rhinoclem-

mys melanosterna): The phylogenetic analy-

sis revealed several geographically delimited

groups within this species and a non-monophy-

letic relationship between species within the R.

melanosterna complex (Fig. 3). An initial sepa-

ration is observed between the Western and

Eastern clades. The Western clade comprises R.

melanosterna turtles from the Pacific plains to

Sinú plains, as well as R. funerea samples from

Central America. On the other hand, the East-

ern clade includes R. melanosterna turtles in

Northeast Colombia, R. diademata from Ven-

ezuela, and R. punctularia from French Guyana.

The Western clade was further subdivided

into samples of R. funerea from Central Ameri-

ca and R. melanosterna in West Colombia. The

latter was also subdivided into samples from

the Northwest and those in the Southwest.

The Northwest clade showed further subdivi-

sion into two genetic groups. The first one

was predominantly delimited to the Northwest

area (RH-NW), encompassing samples from

the North of the Pacific Plains (Antioquia and

North-Chocó) and those in the North of the

Sinú Valleys. The second one grouped samples

from the Southern part of the Sinú Valleys (RH-

SSV) close to the Mompos Depression. On the

other hand, in the Southwest clade, two genetic

groups were observed. The first one included

samples from the delta of the San Juan River in

Chocó (RH-RSJ), and the other extended from

the central to the Southern part of the Pacific

Plains (RH-PPCS), ranging from South Chocó

and Valle del Cauca in Colombia to the North-

west of Ecuador.

In the Eastern clade, we observed a separa-

tion into two groups. The first one correspond-

ed to samples from the Magdalena Valleys

(RH-MV), and the second one included turtles

in the East. The latter clade was subsequently

divided into a group comprising samples from

the R. punctularia in French Guyana (RH-RP)

and an aggregation of R. melanosterna from the

East Caribe savannas of Colombia (RH-EC)

and R. diademata from Venezuela (RH-RD).

The haplotype and RhierBAPS analy-

sis (Fig. 4A, Fig. 4C) predicted eight genetic

groups within this turtle. These groups align

with the previously described clades in the

phylogenetic analysis. However, the RH-EC

and RH-RD clades were grouped into a single

genetic group (RH-E). Nonetheless, they pos-

sess distinctive haplotypes. In the phylogenetic

and haplotype analyses, one sample from the

North of the Sinú Valleys has a genotype asso-

ciated with the Southern Sinú genetic group

(RH-SSV), and one sample from the central

part of the Pacific plain was grouped under the

Northwest group (RH-NW). Apart from these

exceptions, the geographic regions exhibited a

strong genetic identity, with no shared haplo-

types among them.

We explored the genetic differences

between the North-West, Pacific Plains-Río

San Juan, Pacific Plains Central-South, Mag-

dalena Valleys, East Caribe Savannas, and East

Colombia-Venezuela (R. diademata) geograph-

ic regions using the AMOVA test. We excluded

the R. punctularia and R. funera groups from

the analysis, as they were represented by only

three and two samples, respectively, which

could lead to biases. Additionally, these groups

already showed a noticeable separation in the

haplotype analysis. Regarding R. diademata,

given that the reference database only included

three samples, we supplemented it with two

additional sequences from seized individuals.

These individuals were identified as belonging

to this species based on reliable morphologi-

cal differences particularly the coloration pat-

terns. These analyses confirmed the genetic

differences between geographic regions (p <

0.001) with 94 % of the variance found between

populations. The pairwise analysis revealed a

significant difference between all the regions

(p < 0.05). The genetic distances between the

10 Revista de Biología Tropical, ISSN: 2215-2075 Vol. 73: e00000, enero-diciembre 2025 (Publicado Abr. 28, 2025)

Fig. 3. Bayesian inference tree of the CYTB gene for the Colombian wood turtle. The corresponding support values are shown

as posterior probability (PP) (left) and bootstrap support (right).

Revista de Biología Tropical, ISSN: 2215-2075, Vol. 73: e00000, enero-diciembre 2025 (Publicado Abr. 28, 2025)

regions ranged from 0.3-3.5 %, being lower

when compared to geographically close groups,

while higher when comparing groups in distant

localities (SMT 2).

We used the CYTB reference to iden-

tify the most probable origin for 11 seized

individuals and 27 turtles from the ex-situ

conservation program of the EBTRF. Of the

seized individuals, nine corresponded to R.

melanosterna, and seven of them were assigned

to the East clade, with six associated with the

Magdalena Valley (RH-MV) group, and one

to the East group (RH-E) having the genotype

of East Colombia (RH-EC, E-1). According to

the haplotypes, those of the Magdalena most

likely come from the middle Magdalena-inter

Fig. 4. A. Haplotype network of the Colombian wood turtle constructed using sequences from individuals with known

geographic origins. B. Haplotype network of Colombian wood turtle including sequences from seized individuals in

Colombia. Hatch marks indicate the number of mutations separating each haplotype. Colored boxes represent the haplotypes

grouped under a population according to RhierBAPS Analysis. C. Haplotype map plot for the Colombian wood turtle.

The size of the circles indicates the number of samples with a respective haplotype. In set photography of an adult female

Rhinoclemmys melanosterna from the EBTRF. Photo by Juan Manuel Vargas Ramírez.

12 Revista de Biología Tropical, ISSN: 2215-2075 Vol. 73: e00000, enero-diciembre 2025 (Publicado Abr. 28, 2025)

Andean Valley. Only two of these samples were

associated with the West clade, both assigned to

the Central to South Pacific Plains (RH-PPCS)

group. The other two seized turtles correspond-

ed to R. diademata, and as expected, were asso-

ciated with the East group (RH-E). However,

both presented new haplotypes, with one of

them (E-6) showing a noticeable degree of sep-

aration from previously reported haplotypes.

In contrast, all the Colombian wood turtles

being used in the EBTRF conservation pro-

gram were assigned to groups on the Western

clade (Fig. 4B). 44 % (12) of the samples were

assigned to the Central to South Pacific Plains

(RH-PPCS) group, 37 % (10) to the Southern

Sinú plains (RH-SSV), 11 % (3) to the Pacific

Plains-Río San Juan (RH-RSJ), and 7 % (2) to

the North-West group (RH-NW).

Freshwater Colombian slider turtle

(Trachemys venusta callirostris): The phyloge-

netic analysis (Fig. 5) shows two separate clades

within the Colombian territory. The first one

grouped turtles from the Northern region of

the country across the Caribe lowlands (TC-N),

while the second one corresponded to turtles

from the inter-Andean valley at the middle

Magdalena plains area (TC-IA). The haplo-

type and RhBAPS analysis (Fig. 6A, Fig. 6C)

also indicated these two genetic groups. The

AMOVA test showed a significant genetic dif-

ference between these two regions (p < 0.001)

with 81 % of the variance found between popu-

lations. The genetic distance between these two

groups was relatively low, at 0.6 %.

Using this information, we estimated the

provenance of 32 seized turtles and 10 indi-

viduals from the EBTRF conservation pro-

gram. All the individuals of seized turtles were

assigned to the Northern group (Fig. 6C). Also,

most of the turtles from the EBTRF (nine indi-

viduals) were assigned to the Northern group,

while only one sample had the inter-Andean

genotype. Table 1 presents a summary of the

Table 1

Number of individuals, haplotypes and proposed independent conservation units.

Species n known

origin

n unknown

origin

total

N° of

haplotypes

(known origin)

N° of haplotypes

(known origin +

seized individuals)

Proposed

Conservation Units

AMOVA

test

Red-footed tortoise

(C. carbonarius)

189 77 266 25 32 • CH-PA.Paraguay

• CH-FG. French Guiana

• CH-OL.Orinoco Llanos

• CH-TA. Trans Andean

• Guajira

• East Caribe savannas and

Magdalena valleys

• Sinú valleys

• Pacific Plains

p < 0.01

FST = 0.83

Colombian wood turtle

(R. melanosterna)

103 38 141 25 28 • NW.North-West

• SSV. South Sinú Valleys

• RSJ. Pacific Plains-Río San

Juan

• PPCS. Central to South

Pacific Plains

• MV. Magdalena Valleys

• E. East

• East Caribe savannas

• R. diademata

• RF. Rhinoclemmysfunerea

• RP. Rhinoclemmyspunctularia

p < 0.001

FST = 0.94

Freshwater Colombian

slider turtle

(T. v. callirostris)

58 42 100 16 23 • N. North

• IA. Inter Andean

p < 0.001

FST = 0.81

Revista de Biología Tropical, ISSN: 2215-2075, Vol. 73: e00000, enero-diciembre 2025 (Publicado Abr. 28, 2025)

Fig. 5. Bayesian inference tree of the CR gene tree for the Colombian slider turtle. The corresponding support values are

shown as posterior probability (PP) (left) and bootstrap support (right).

14 Revista de Biología Tropical, ISSN: 2215-2075 Vol. 73: e00000, enero-diciembre 2025 (Publicado Abr. 28, 2025)

Fig. 6. A. Haplotype network of the Freshwater Colombian slider turtle constructed using sequences of individuals with

known geographic origins. B. Haplotype network of the Freshwater Colombian slider turtle including sequences from

seized individuals in Colombia. Hatch marks indicate the number of mutations separating each haplotype. Colored boxes

represent the haplotypes grouped under a population according to RhierBAPS Analysis. C. Haplotype map plot for the

Freshwater Colombian slider turtle. The size of the circles indicates the number of samples with a respective haplotype. In

set photography of an adult female Trachemys venusta callirostris from the EBTRF. Photo by Juan Manuel Vargas Ramírez.

Revista de Biología Tropical, ISSN: 2215-2075, Vol. 73: e00000, enero-diciembre 2025 (Publicado Abr. 28, 2025)

results from the haplotype and genetic differ-

ences analysis, along with the phylogeographic

groups and proposed independent conserva-

tion units.

DISCUSSION

Our results confirmed the existence of

intraspecific genetic diversity and structure

in two continental freshwater turtles and one

tortoise from Colombia. Furthermore, we

observed that captive individuals from confis-

cations and an ex-situ conservation program

originate from multiple genetic/geographic

groups. This emphasizes the significance of

a thorough release process for captive indi-

viduals, and the importance of such programs

in preserving the species’ genetic diversity.

Colombian environmental law recognizes the

risk of genetic contamination to wildlife popu-

lations during release processes and advocates

for the use of genetic tests to assess genetic vari-

ability before the release of seized individuals

(Choperena-Palencia & Mancera-Rodríguez,

2016; MADS Resolución 2064, 2010). Never-

theless, the insufficient understanding of the

phylogeography and population genetics of

traded turtle species, coupled with the absence

of standardized and validated laboratory and

analytical protocols, has restricted the applica-

tion of genetic analysis to inform the release of

individuals. Consequently, a significant portion

of reintroduction and release processes in the

country occurs without reliable information

about the animals’ geographic origin, attracting

significant criticism (Jiménez & Cadena, 2004).

Documented efforts to enhance translo-

cation protocols for seized or captive wild-

life in the country are relatively scarce. In

the case of turtles, a study on the Orinoco

matamata turtle (Chelus orinocensis) utilized

mitochondrial COI and CR regions to deter-

mine the most probable geographic origin of

seized individuals. The findings revealed that,

despite being rescued in Leticia-Amazonas,

they originated from a distant locality in the

Orinoco Llanos, allowing for the proper release

of the individuals to their original geographic

region (Lasso et al., 2018). Additionally, a study

on the savanna side-necked turtle (Podocne-

mis vogli) employed microsatellite markers to

estimate the origin of 26 captive individuals

(Cárdenas-Barrantes et al., 2024).

Internationally, there are more instances

of the use of forensic DNA analysis to study

the trade of turtles and improve translocation

processes. A study utilizing CYTB allowed

for the approximation of geographic origin in

the endangered European pond turtles (Emys

orbicularis) retrieved from recovery centers in

Spain, Portugal, and Morocco (Velo-Antón et

al., 2021). In Asia, CYTB and CR genes were

employed to address the geographic origin

of seized Star tortoises (Geochelone elegans),

enabling their repatriation to their original

populations (Gaur et al., 2006). Similarly, this

approach has been used in Hawksbill turtles

(Eretmochelys imbricata) and green turtles (Che-

lonia mydas), allowing for the identification of

hunting hotspots (Joseph et al., 2019; LaCa-

sella et al., 2021). These previous works and

our results highlight the importance of genetic

analysis in the management of seized turtles.

Red-footed tortoise (Chelonoidis carbon-

arius): In agreement with previous research,

our study revealed a substantial phylogeo-

graphic structure in the red-footed tortoise

across its distribution range. We identified

four main clades geographically delimited to

the Southwest in Paraguay, an Eastern clade in

French Guiana, the Orinoco Llanos of Colom-

bia, and the Trans-Andean region. The original

work that explored the CYTB genetic structure

in the species also demonstrated these four

major clades and reported an additional one

in Brazil (Vargas-Ramírez et al., 2010). Sub-

sequently, a study utilizing RADseq analysis

(30 327 neutral SNPs) to compare the genetic

structure of the Orinoco Llanos and Trans-

Andean groups revealed significant differences

between them, providing evidence of allopatric

reproductive isolation, local adaptation, and

ecological divergence (Gallego-García et al.,

2023). The multilocus SNPs genomic analy-

sis revealed moderately differentiated clusters

16 Revista de Biología Tropical, ISSN: 2215-2075 Vol. 73: e00000, enero-diciembre 2025 (Publicado Abr. 28, 2025)

within the Trans-Andean region, proposing

four management units: the Caribbean Coast

(Magdalena River Delta to the Sinú Valleys),

the Darien Mountain Forest (Pacific plains), the

Rainforest of the Magdalena River Valley (East

Caribe savannas), and the Tropical Dry Forest

in the inter-Andean valleys (Middle Magdalena

inter-Andean Valleys) (Gallego-García et al.,

2023). Our study also detected a significant,

albeit less pronounced structure among ecore-

gions in the Trans-Andean region of Colombia.

However, we did not observe a significant dif-

ference between the East Caribe savannas and

the Middle Magdalena inter-Andean Valleys.

Additionally, our analysis indicated that sam-

ples from the Magdalena River basin were more

closely related to those from the East Caribe

savannas than to the Sinú valley. Furthermore,

with the inclusion of samples from the Guajira

Peninsula, we identified a significant structure

in this region. Given the higher resolution and

more comprehensive information provided by

RADseq data, we recommend maintaining the

proposed geographic delimitations for manage-

ment units as suggested by Gallego-García et al.

2023, while incorporating the Guajira Penin-

sula as a new separate management unit.

The observed patterns of defined phylo-

geographic groups with the admixture of indi-

viduals in the Trans Andean region have been

linked to the recent natural and/or human-

mediated dispersion of the species (Gallego-

García et al., 2023). This is one of the most

traded reptiles in the country and unlike other

turtles; it is primarily sought after as a pet rath-

er than for use in food products (Echeverry-

Alcendra, 2019). Consequently, this species is

susceptible to being artificially translocated and

colonizing areas far from their original habitat,

either through escape or intentional release by

their owners.

The analysis of seized individuals revealed

that red-footed tortoises recovered in the cen-

tral part of Colombia originate from several

regions and genetically distinct groups along

the country. Both the Trans Andean and Orino-

co Llanos were identified as sources for traded

tortoises, with a higher number of specimens

assigned to the former (75 % vs. 25 %, respec-

tively). Within the Trans Andean clade, the

Northeastern territory of the Guajira Peninsula

and East Caribe Savannas to Middle Magdalena

inter-Andean Valleys were the most affected.

Nevertheless, the ecoregions of the Northwest

also appear to be used as hunting sites, but in

lower proportions.

The extraction of individuals from various

regions of the country explains the high num-

ber of reported seizures of this turtle, making it

one of the two most traded turtles in Colombia

(Arroyave-Bermudez et al., 2014). It has been

documented that hunting and exploitation of

this species in the Orinoco Llanos are com-

mon, and trade networks in the area include

both local consumption and transportation

outside the country to Venezuela (Medina-

Rangel, 2015). Thus, not all poached individu-

als are transported to the interior of Colombia,

and although we found a lower number of

individuals coming from the Orinoco Llanos

compared to those from the Trans-Andean

region, the severity of hunting in this region

should not be underestimated.

A previous study on the trade networks of

the species, relying on information about the

seizure place and reported origin collected by

environmental entities in Colombia, suggested

that Chelonoidis turtles seized in Cundina-

marca were primarily (or exclusive) harvested

from the Orinoco Llanos, and that this region

served as an “intermediate or passage area”

for their mobilization to Northern areas like

Antioquia and Santander (Arroyave-Bermudez

et al., 2014). However, our results contradict

this hypothesis, as only a fraction of the turtles

seized in Cundinamarca originated from the

Orinoco Llanos. The majority came from mul-

tiple areas of the Trans Andean Coastal regions.

It is also noteworthy that the Red-footed tortoise

is the most seized reptile in the central region of

Colombia (Cundinamarca and Boyacá), rep-

resenting up to 65 % of the seized reptiles

(Suárez-Giorgi, 2016). The substantial number

of traded individuals obtained from various

regions across the country, implies that central

regions of Colombia, such as Cundinamarca,

Revista de Biología Tropical, ISSN: 2215-2075, Vol. 73: e00000, enero-diciembre 2025 (Publicado Abr. 28, 2025)

may function as the final destination or a dis-

tribution hub for multiple trade networks in the

country. Moreover, the discrepancies between

studies may suggest that information collected

during the rescue process is unreliable, possibly

due to traders concealing or falsifying details

about the trade networks. However, these dif-

ferences may also be attributed to the varying

timeframes of the studies, reflecting shifting

trends in consumption and hunting preferences

across different sampling periods.

Our results emphasize the importance of

conducting release processes of this turtle with

proper genetic analysis, given its pronounced

phylogeographic structure, the diverse origin

of seized individuals, and the lack of reported

morphological differences between genetic

groups. This highlights the necessity for a revi-

sion of the current release protocols, as the

widespread release of seized individuals with-

out information about their geographic origins

is a common practice (Echeverry-Alcendra,

2019; Medina-Rangel, 2015).

Our data also emphasizes the significance

of genetic evaluation in ex-situ conservation

programs. In the case of the four individuals

from the EBTRF, three of them originate from

the Orinoco Llanos, and one is most likely from

the Guajira Peninsula. Consequently, we rec-

ommend segregating of Cis Andean individuals

to prevent unintended hybridization. Moreover,

we suggest expanding the representation of

individuals from the Trans Andean region,

encompassing a broader range of ecoregions

and genetic groups to ensure the preservation

of the genetic diversity within the species.

Additionally, increasing the number of animals

in this conservation strategy is crucial, as a

minimum of 15 founders is recommended to

minimize the loss of genetic diversity (Witzen-

berger & Hochkirch, 2011).

In the country, there are also zoo-breeding

farms for the species that are mandated by

law to release part of the breeding animals as

part of the repopulation quotas, intending to

improve the conservation status of the spe-

cies (Echeverry-Alcendra, 2019). However, our

results indicate that these actions may pose a

risk of genetic contamination to the receiving

populations. Therefore, genetic evaluation of

animals in zoo-breeding farms is also necessary

to meet the conservation expectations of these

sustainable use initiatives.

Colombian wood turtle (Rhinoclemmys

melanosterna): We identified a significant phy-

logeographic structure in the R. melanosterna

complex, comprising eight distinctive genetic

groups. Our results align with the phylogeo-

graphic analysis conducted by Vargas-Ramírez

et al. (2013), but the inclusion of new samples

has led to some changes in the delimitations

proposed by the authors. Our findings support

the separation of R. funerea from Centro Amer-

ica (RH-RF) and R. punctularia (RH-RP) from

French Guyana as distinctive genetic groups.

Additionally, we concur with the grouping

of R. diademata and R. melanosterna in the

East Caribe savannas as a single genetic group

(RH-E), albeit with distinctive haplotypes. Fur-

thermore, our results confirm the presence of

a genetic group in the South of the Sinú plains

(RH-SSP), near the Mompos Depression.

In the original study, two phylogroups were

proposed for the Northwest, one in the North

of the Pacific plains extending from Panama

to the North of the Sinú plains in Colombia,

and a second in the Urabá-Antioquia region.

However, the second group was represented by

a single sample (Vargas-Ramírez et al., 2013).

In our analysis, we included more samples from

Urabá in Antioquia, as well as samples from

North Chocó, and found a single genetic group

for the Northwest of South America, spanning

from the North of the Pacific plains (includ-

ing the Urabá-Antioquia region, North Chocó,

and Panama) to the North of the Sinú plains

(RH-NW).

In a previous study, a genetic group was

identified in the Southwest Pacific plains and

hypothesized to be distributed throughout the

Chocó region (Vargas-Ramírez et al., 2013).

While we also detected this group, our findings

show that it is restricted to the San Juan River

delta (RH-SJR) rather than the entire Chocó

region. The original analysis also described a

18 Revista de Biología Tropical, ISSN: 2215-2075 Vol. 73: e00000, enero-diciembre 2025 (Publicado Abr. 28, 2025)

genetic group extending from Valle del Cauca

to Northwest Ecuador (Vargas-Ramírez et al.,

2013), but our results indicate that this group is

also present in the Southern part of the Chocó

region (CSPP).

In the Eastern region of Colombia, Vargas-

Ramírez et al. (2013) described a genetic group

delimited to the Middle Magdalena Inter-Ande-

an Valley. Our analysis also supports this group

and expands its range to the Magdalena River

basin, suggesting that this clade is distributed

across the low and middle Magdalena valley.

Given the notable phylogenetic structure

in this turtle, we successfully identified the

most probable origin of 11 seized individu-

als. Our findings indicate that turtles rescued

from illegal trade have diverse origins, with

a more pronounced impact on the Eastern

part of the country, particularly in the Middle

Magdalena inter Andean valley, which is closer

to the interior of the country (Cundinamarca)

where the individuals were seized. However,

two individuals were assigned to a markedly

distant area in the central-South Pacific plains,

indicating that commercialization from distant

trade networks also occurs. The two samples

from the Maracaibo wood turtle (Rhinoclem-

mys diademata) were, as expected, associated

with the East group but presented new haplo-

types. The reference database only had a few

samples of this turtle from Venezuela, poten-

tially explaining the reported new haplotypes,

as the seized individuals most likely come

from the Colombian populations. Consider-

ing the species’ distribution range, they most

likely come from the Eastern part of Norte de

Santander, which is its only area of distribution

in Colombia (Armesto et al., 2014).

The strong phylogeographic structure of

natural populations and heterogeneity in the

origin of seized individuals underscore the

necessity for the release process to involve

proper genetic analysis or reliable information

about the geographic origin of the animals. In

this turtle species, differences in head stripe

patterns between geographic regions have

been reported and could potentially serve as

a simpler and more cost-effective method for

determine their origin (Vargas-Ramírez et al.,

2013). However, the reliability of this method

has not been tested, and these types of morpho-

logical traits are not always clear across differ-

ent individuals, especially in juveniles.

The trade networks of this species in

Colombia remain largely unknown, and the

extent of distribution routes, particularly for the

pet trade, has not been characterized (Echever-

ri-García et al., 2012). This lack of information

limits the development of proper management

plans to address the illegal trade of this turtle,

a notable problem, given that seized reports

of Rhinoclemmys turtles have been drastically

increasing (Arroyave-Bermudez et al., 2014).

Our analysis unveiled at least four trade net-

works for this turtle, involving the supply of

individuals to the central part of the country

from their extraction areas in the Magdalena

valleys, East Caribe plains (in Cesar), Norte de

Santander, and the central-South Pacific plains.

This data aligns with information regarding

the harvesting of this turtle in the communities

from the Magdalena valley and Pacific Plains

(Echeverri-García et al., 2012). However, com-

mercialization of this turtle is relatively low

in the central region of Colombia compared

to Chelonoidis and Trachemys turtles (Suárez-

Giorgi, 2016), while in other markets, like

Buenaventura and Cali, this is one of the most

traded turtles (Corredor et al., 2007). Thus,

replicating this analysis in other regions of

the country would be valuable to gain a better

understanding of the trade networks.

The analysis of turtles from the EBTRF

revealed that this conservation program has

representation from the four Western genetic

groups, while there was no representation from

the Eastern clades. Thus, the separation of

the turtles according to their assigned phy-

logeographic group is necessary to avoid the

generation of hybrids with potentially lower

environmental adaptability (Barbanti et al.,

2019; Weeks et al., 2011). We also recommend

including founders from the Eastern clades to

formulate a more comprehensive conserva-

tion plan that preserves the genetic diversity

of the country.

Revista de Biología Tropical, ISSN: 2215-2075, Vol. 73: e00000, enero-diciembre 2025 (Publicado Abr. 28, 2025)

Freshwater Colombian slider turtle

(Trachemys venusta callirostris): Unlike previ-

ous examples, the freshwater Colombian slider

turtle exhibited a less pronounced phylogeo-

graphic structure with only two differentiable

groups. The first group (TC-N) was in the

North of Colombia across the Caribbean plains

(including the Magdalena and Sinú valleys)

and the Guajira Peninsula. The second group

corresponded to turtles from the middle Mag-

dalena inter-Andean valleys (TC-IA). These

were the same groups reported in the original

study on the species used as a reference data-

base. The author of this population genetic

study additionally used microsatellite markers,

retrieving also these two populations (Balcero-

Deaquiz, 2022). This is consistent with a study

using allozyme analysis in turtles from the

Caribbean plains at the Mompos Depression,

which found low genetic variability and a lack

of structuration (Martínez et al., 2007). Thus,

there is no evidence of additional structuration

in the country.

All 32 seized turtles evaluated were assigned

to the North group, suggesting stronger exploi-

tation of the Northern coastal plains popula-

tions. Previous reports have also suggested a

trade network for the species with poaching

in the coastal region towards the interior of

the country in the Antioquia, Quindío, and

Santander departments (Arroyave-Bermudez

et al., 2014). Our results support the hypothesis

of an extraction center in the Caribbean coastal

region and suggest that part of these harvested

turtles also supplies the demand in the most

central regions of Cundinamarca department.

Our analysis suggests that the liberation

process of individuals from the central region

of Colombia should focus on the coastal region

of the country to avoid genetic contamina-

tion in the inter-Andean populations. How-

ever, we recommend further evaluations with

larger sample sizes to better assess the use (if

any) of the inter-Andean group in the trade

network. Considering that this species is the

most exploited turtle in Colombia, with mil-

lions of individuals harvested yearly (Restrepo

et al., 2014), a precise evaluation of trade

patterns may require a higher number of sam-

ples. This characterization is important as there

are not reported morphological characteristic

that allow the differentiation between the two

genetic groups.

It is important to note that the pattern

found in the central part of the country (Cun-

dinamarca) may differ in other areas with an

even higher demand for the species, such as

Antioquia and Santander (Arroyave-Bermudez

et al., 2014). Considering that the Inter-Andean

clade is distributed within the Santander and

Antioquia territories, it may be exploited to

supply the internal demand in these areas.

Hence, genetic analysis of seized samples from

other territories is required to better under-

stand the trade networks and define the most

adequate release protocols for the species.

Regarding the EBTRF samples, nine out of

10 also came from the Northern coastal clade,

while only one of them was associated with the

middle Magdalena Inter-Andean region. Thus,

we suggest separating this individual to pre-

vent unwanted crossbreeding. Additionally, we

recommend increasing the number of found-

ers from the Inter-Andean region to establish

a program preserving both lineages within

the country.

General remarks: Our study significantly

contributes to the understanding of the phylo-

geographic structure of turtles of conservation

concern within the Colombian territory. We

emphasize the importance of developing intra-

specific conservation plans for these turtles,

utilizing the proposed phylogeographic groups

as independent conservation units. Addition-

ally, our findings underscore the critical need

to improve the management practices for

captive individuals, particularly in transloca-

tion and release processes, to prevent genet-

ic contamination and potential outbreeding

depression in wild populations. Consequently,

genotyping seized individuals and founders

from ex-situ conservation programs should be

a mandatory step before their release or use in

breeding programs.

20 Revista de Biología Tropical, ISSN: 2215-2075 Vol. 73: e00000, enero-diciembre 2025 (Publicado Abr. 28, 2025)

While this study focused on three turtle

species, it is crucial to acknowledge the docu-

mented evidence of genetic structure within

Colombia for other turtles commonly involved

in illegal trade, such as the scorpion mud tur-

tle (Kinosternon scorpioides), matamata turtles

(Chelus spp.), the side-necked turtle (Podocne-

mis vogli), and the Magdalena River turtle

(Podocnemis lewyana) (Cárdenas-Barrantes et

al., 2024; Hurtado-Gómez et al., 2024; Vargas-

Ramírez et al., 2012, Vargas-Ramírez et al.,

2020). Therefore, obtaining information on

the geographic origin should be a preliminary

step in the release process for all turtle species,

unless evidence demonstrating a lack of genetic

structure in their populations is available.

This study validates the efficacy of mito-

chondrial markers for approximating the geo-

graphic origin of three of the most traded

turtles in Colombia. We recommend the use of

these tools to inform the management of seized

individuals, contributing to more effective

and secure release programs as a conservation

strategy. Additionally, we propose employing

these markers in the initial decision-making

processes for managing and forming repro-

ductive groups in ex-situ breeding programs.

For this propose the level of classification pre-

sented different degrees of confiability among

the studied species. For T. v. callirostris and

R. melanosterna, the phylogeographic groups

were more distinctly differentiated, resulting

in higher confidence in their assignment. In

contrast, for C. carbonarius, only the division

between trans-Andean and cis-Andean groups

was clearly defined, while differentiation within

the trans-Andean regions was less evident (with

shared haplotypes across regions), making the

assignments less reliable.

Our study underscores the potential of

molecular tools to reconstruct trade networks

in Colombia and to verify current trafficking

route hypotheses. However, a more accurate

reconstruction would require extensive sam-

pling across additional regions and the inte-

gration of other data sources to better identify

poaching locations and transport routes. Our

study also provides an initial understanding of

the most vulnerable regions targeted by hunt-

ers. However, the phylogeographic analyses

have relatively limited resolution, allowing us

to identify only broad ecoregions in the coun-

try. To achieve a more precise determination

of poaching areas, the use of additional tools

would be required.

It is important to note that mitochondrial

markers only provide information about the

maternal genotype and do not identify indi-

viduals resulting from hybridization between

lineages. Therefore, in cases where there are

concerns about potential hybridization, the use

of additional markers such as microsatellite or

SNPs data is crucial. This is particularly rel-

evant in ex-situ conservation programs and zoo

breeding centers that lack proper documenta-

tion on the origin of founder animals over

several generations. Additionally, the incorpo-

ration of additional markers offers insights into

genetic diversity, inbreeding, heterozygosity,

parental veracity, and relatedness; important

information for determining the fitness of cap-

tive populations and their suitability for trans-

location and release processes (Barbanti et al.,

2019; Saldarriaga-Gómez et al., 2023).

Ethical statement: The authors declare

that they all agree with this publication and

made significant contributions; that there is

no conflict of interest of any kind; and that we

followed all pertinent ethical and legal proce-

dures and requirements. All financial sources

are fully and clearly stated in the acknowled-

gments section. A signed document has been

filed in the journal archives.

See supplementary material

a24v73n1-suppl1

ACKNOWLEDGMENTS

Thanks to Wild Animal Rescue and Reha-

bilitation Unit (URRAS), the Regional Autono-

mous Corporation of Cundinamarca (CAR),

and the Estación de Biología Tropical Rober-

to Franco (EBTRF) for granting us access to

the captive turtle’s samples. Thanks to Natalia

Revista de Biología Tropical, ISSN: 2215-2075, Vol. 73: e00000, enero-diciembre 2025 (Publicado Abr. 28, 2025)

Gallego-García, Olga Victoria Castaño-Mora,

and Vivian P. Páez for support with sampling.

Thanks to Uwe Fritz and the Museum of

Zoology Senckenberg, Dresden, Germany, for

academic assistance. Thanks to the Digital

Cooperation Grant of the Alexander von Hum-

boldt Foundation in Germany for financial sup-

port. We thank the Servicio de Secuenciación y

Análisis Molecular (SIGGMOL) for support in

obtaining the genetic data. Many thanks to Her-

nan Mariño and Sebastián Briceño for helping

processing samples included in this research.

Samples were processed under the “Permiso

Marco de Recolección de especímenes de espe-

cies silvestres de la Diversidad Biológica con

fines de investigación científica no comercial

Resolución 0255-2014”, given by Autoridad

Ambiental de Licencias Ambientales ANLA to

Universidad Nacional de Colombia, suscribed

by Grupo Biodiversidad y Conservación Gené-

tica de la Universidad Nacional de Colombia.

REFERENCES

Alacs, E. A., Janzen, F. J., & Scribner, K. T. (2007). Genetic

issues in freshwater turtle and tortoise conservation.

Chelonian Research Monographs, 4, 107–123.

Arantes, L. S., Ferreira, L. C. L., Driller, M., Repinaldo-

Filho, F. P. M., Junqueira-Mazzoni, C., & Rodrí-

gues-Santos, F. (2020). Genomic evidence of recent

hybridization between sea turtles at Abrolhos Archi-

pelago and its association to low reproductive output.

Scientific Reports, 10, 12847. https://doi.org/10.1038/

s41598-020-72367-y

Armesto, O., Acevedo, A. A., Gallardo, A., & Franco, R.

(2014). Rhinoclemmys diademata (Mertens, 1954).

En V. P. Páez (Ed.), Catálogo de anfibios y reptiles de

Colombia (pp. 47–52). Asociación Colombiana de

Herpetología.

Arroyave-Bermudez, F. J., Romero-Goyeneche, O. Y., Boni-

lla-Gómez, A., & Hurtado-Heredia, R. G. (2014).

Tráfico ilegal de tortugas continentales (Testudinata)

en Colombia: Una aproximación desde el análisis de

redes. Acta Biológica Colombiana, 19(3), 381–392.

Balcero-Deaquiz, M. C. (2022). Genética poblacional de la

tortuga icotea colombiana Trachemys venusta calli-

rostris (Testudines: Emydidae), proponiendo estrategias

para su conservación [Master´s thesis]. Universi-

dad Nacional de Colombia. Repositorio Universidad

Nacional. https://repositorio.unal.edu.co/handle/

unal/84508

Barbanti, A., Martin, C., Blumenthal, J. M., Boyle, J., Bro-

derick, A. C., Collyer, L., Ebanks-Petrie, G., Godley,

B. J., Mustin, W., Ordóñez, V., Pascual, M., & Carre-

ras, C. (2019). How many came home? Evaluating

ex situ conservation of green turtles in the Cayman

Islands. Molecular Ecology, 28(7), 1637–1651. https://

doi.org/10.1111/mec.15017

Bernal-Restrepo, M. P. (2021). Distribución del tráfico ilegal

de reptiles en áreas específicas de Colombia [Degree

thesis]. Pontificia Universidad Javeriana. Repositorio

Institucional Javeriano. https://repository.javeriana.

edu.co/handle/10554/55757

Böhm, M., Collen, B., Baillie, J. E. M., Bowles, P., Chanson,

J., Cox, N., Hammerson, G., Hoffmann, M., Livings-

tone, S. R., Ram, M., Rhodin, A. G. J., Stuart, S. N.,

van Dijk, P. P., Young, B. E., Afuang, L. E., Aghas-

yan, A., García, A., Aguilar, C., Ajtic, R., ... Zug, G.

(2013). The conservation status of the world’s reptiles.

Biological Conservation, 157, 372–385. https://doi.

org/10.1016/j.biocon.2012.07.015

Bock, B. C., Páez, V. P., & Cortés-Duque, J. (2015). Hicotea

(Trachemys callirostris). En J. C. Arredondo (Ed.),

Libro rojo de reptiles de Colombia (pp. 166–171).

Instituto de Investigación de Recursos Biológicos

Alexander von Humboldt (IAvH).

Cárdenas-Barrantes, M., Matta, N. E., Rodríguez-Fandiño,

O. A., Fritz, U., & Vargas-Ramírez, M. (2024). Genetic

structure and loss of genetic diversity in the savan-

nah side-necked turtle Podocnemis vogli (Testudines:

Podocnemididae). Chelonian Conservation and Biolo-

gy, 23(1), 92–102.

Castro-Cortés, A. A., Brieva, C., & Witte, C. (2022).

Implications of wildlife trafficking on the health and

conservation efforts of an endangered turtle species

in Colombia. Conservation Science and Practice, 4(3),

e595. https://doi.org/10.1111/csp2.595

Choperena-Palencia, M. C., & Mancera-Rodríguez, N. J.

(2016). Lineamientos para el seguimiento y moni-

toreo post-liberación de fauna silvestre rehabilitada.

Revista U.D.C.A Actualidad & Divulgación Científica,

19(2), 411–424. https://doi.org/10.31910/rudca.v19.

n2.2016.96

Corredor, G., Kattan, G. H., Galvis-Rizo, C. A., & Amoro-

cho, D. (2007). Tortugas del Valle del Cauca. Corpora-

ción Autónoma Regional del Valle del Cauca.

Cruz, C. E. F., Funkler, G. R., Zani, A. L. S., Wagner, P. G.

C., Andretta, I., Segura, L. N., & Fagundes, N. J. R.

(2021). A preliminary assessment of the potential

health and genetic impacts of releasing confiscated

passerines into the wild: A reduced-risk approach.

Frontiers in Veterinary Science, 8, 679049. https://doi.

org/10.3389/fvets.2021.679049

D’Cruze, N., Singh, B., Morrison, T., Schmidt-Burbach,

J., Macdonald, D. W., & Mookerjee, A. (2015).

A star attraction: The illegal trade in Indian Star

22 Revista de Biología Tropical, ISSN: 2215-2075 Vol. 73: e00000, enero-diciembre 2025 (Publicado Abr. 28, 2025)

Tortoises. Nature Conservation, 13, 1–19. https://doi.

org/10.3897/natureconservation.13.5625

Echeverri-García, L. del P., Carr, J. L., Garcés-Restrepo, M.

F., Galvis-Rizo, C. A., & Giraldo, A. (2012). Rhino-

clemmys melanosterna. En V. P. Páez, M. A. Morales-

Betancourt, C. A. Lasso, O. V. Castaño-Mora, & B.

Bock (Eds.), Biología y conservación de las tortugas

continentales de Colombia (pp. 308–314). Instituto de

Investigación de Recursos Biológicos Alexander von

Humboldt.

Echeverry-Alcendra, A. (2019). Chelonoidis carbonarius

(Spix, 1824): Morrocoyo, morrocoy o morroco. Catá-

logo de Anfibios y Reptiles de Colombia, 5(1), 13–29.

Frankham, R., Ballou, J. D., Eldridge, M. D. B., Lacy, R.

C., Ralls, K., Dudash, M. R., & Fenster, C. B. (2011).

Predicting the probability of outbreeding depression.

Conservation Biology, 25(3), 465–475. https://doi.

org/10.1111/j.1523-1739.2011.01662.x

Fritz, U., Auer, M., Bertolero, A., Cheylan, M., Fattizzo, T.,

Hundsdörfer, A.K., Martín Sampayo, M., Pretus, J.L.,

Široký, P. & Wink, M. (2006). A rangewide phylo-

geography of Hermann’s tortoise, Testudo hermanni

(Reptilia: Testudines: Testudinidae): implications for

taxonomy. Zoologica Scripta, 35, 531–543.

Gaillard, D., Yeh, F. C., Lin, L., Chen, H. Q., Zhang, T.,

Luo, S. J., & Shi, H. T. (2021). Lost at sea: Determi-

ning geographic origins of illegally traded green sea

turtles (Chelonia mydas) rescued on Hainan Island,

China. Wildlife Research, 48(1), 55–63. https://doi.

org/10.1071/WR19127

Gallego-García, N., Vargas-Ramírez, M., & Shaffer, H.

B. (2023). The importance of cryptic diversity in

the conservation of wide-ranging species: The red-

footed tortoise Chelonoidis carbonarius in Colombia.

Molecular Ecology, 32(16), 4531–4545. https://doi.

org/10.1111/mec.17052

Gaur, A., Reddy, A., Annapoorni, S., Satyarebala, B., &

Shivaji, S. (2006). The origin of Indian Star tortoises

(Geochelone elegans) based on nuclear and mitochon-

drial DNA analysis: A story of rescue and repatria-

tion. Conservation Genetics, 7(2), 231–240. https://

doi.org/10.1007/s10592-005-9002-z

Gippoliti, S., Cotterill, F. P. D., Groves, C. P. & Zinner,

D. (2018). Poor taxonomy and genetic rescue are

possible co-agents of silent extinction and biogeo-

graphic homogenization among ungulate mammals.

Biogeographia, 33(1), 41–54. https://doi.org/10.21426/

B633039045

Hurtado-Gómez, J. P., Vargas-Ramírez, M., Iverson, J.,

Joycee, W., McCranief, J., Paetzold, C., & Fritz, U.

(2024). Diversity and biogeography of South Ame-

rican mud turtles elucidated by multilocus DNA

sequencing (Testudines: Kinosternidae). Molecular

Phylogenetics and Evolution, 197, 108083.

Jiménez, I., & Cadena, C. D. (2004). ¿Por qué no liberar

animales silvestres decomisados? Ornitología Colom-

biana, 2, 53–57.

Joseph, J., Nishizawa, H., Alin, J. M., Othman, R., Jolis, G.,

Isnain, I., & Nais, J. (2019). Mass sea turtle slaughter

at Pulau Tiga, Malaysia: Genetic studies indicate

poaching locations and its potential effects. Global

Ecology and Conservation, 17, e00586. https://doi.

org/10.1016/j.gecco.2019.e00586

LaCasella, E. L., Jensen, M. P., Madden Hof, C. A., Bell, I. P.,

Frey, A., & Dutton, P. H. (2021). Mitochondrial DNA

Profiling to Combat the Illegal Trade in Tortoiseshell

Products. Frontiers in Marine Science, 7, 595853.

https://doi.org/10.3389/fmars.2020.595853

Lasso, C. A., Trujillo, F., Morales-Betancourt, M. A., Amaya,

L., Caballero, S., & Castañeda, B. (2018). Conserva-

ción y tráfico de la tortuga matamata, Chelus fimbria-

ta (Schneider, 1783) en Colombia: Un ejemplo del

trabajo conjunto entre el Sistema Nacional Ambiental,

ONG y academia. Biota Colombiana, 19(1), 147–159.

https://doi.org/10.21068/c2018.v19n01a10

Liew, J. H., Kho, Z. Y., Lim, R. B. H., Dingle, C., Bonebrake,

T. C., Sung, Y. H., & Dudgeon, D. (2021). Internatio-

nal socioeconomic inequality drives trade patterns in

the global wildlife market. Science Advances, 7(19),

7679. https://doi.org/10.1126/sciadv.abf7679

Lin, L., Li, S., Chen, M., Parham, J. F., & Shi, H. (2021).

Sea turtle demand in China threatens the survival of

wild populations. iScience, 24(6), 102517. https://doi.

org/10.1016/j.isci.2021.102517

Martínez, L. M., Bock, B. C., & Páez, V. P. (2007). Popu-

lation genetics of the slider turtle (Trachemys

scripta callirostris) in the Mompos Depression,

Colombia. Copeia, 2007(4), 1001–1005. https://doi.

org/10.1643/0045-8511(2007)7[1001:PGOTST]2.0.

CO;2

Martins, S., Ferreira-Veiga, N., Rodrigues, Z., Querido,

A., Loureiro, N. de S., Freire, K., Abella, E., Oujo, C.,

& Marco, A. (2021). Hatchery efficiency for turtle

conservation in Cabo Verde. MethodsX, 8, 101518.

https://doi.org/10.1016/j.mex.2021.101518

Medina-Rangel, G. F. (2015). Chelonoidis carbonarius (Spix,

1824). En M. A Morales-Betancourt, C. A. Lasso, V.

P. Páez, & B. C. Bock (Eds.), Libro rojo de reptiles de

Colombia (pp. 172–175). Instituto de Investigación

de Recursos Biológicos Alexander von Humboldt

(IAvH).

Mendivelso-Gamboa, D. A., & Montenegro, O. L. (2007).

Diagnóstico del tráfico ilegal y del manejo post

decomiso de fauna silvestre en nueve corporaciones

autónomas regionales de Colombia. Acta Biológica

Colombiana, 12, 125–127.

Miller, E. A., McClenachan, L., Uni, Y., Phocas, G., Hage-

mann, M. E., & Van Houtan, K. S. (2019). The

Revista de Biología Tropical, ISSN: 2215-2075, Vol. 73: e00000, enero-diciembre 2025 (Publicado Abr. 28, 2025)

historical development of complex global trafficking

networks for marine wildlife. Science Advances, 5(3),

5948. https://doi.org/10.1126/sciadv.aav5948

Ministerio de Ambiente y Desarrollo Sostenible [Minis-

try of Environment and Sustainable Development

of Colombia]. (2010, octubre 21). Resolución

2064 de 2010. https://www.minambiente.gov.co/

documento-entidad/resolucion-2064-de-2010/

Montague, L. E., Marcotrigiano, J. M., Keane, N. E., Mar-

quardt, H. E., Sevin, J. A., & Karraker, N. E. (2022).

Online sale of small turtles circumvents public

health regulations in the United States. PLoS ONE,

17(12), e0278443. https://doi.org/10.1371/journal.

pone.0278443

Morales-Betancourt, M. A., Lasso, C. A., Páez, V. P., &

Bock, B. C. (Eds.). (2015). Libro rojo de reptiles de

Colombia. Instituto de Investigación de Recursos

Biológicos Alexander von Humboldt, Universidad de

Antioquia.

Oklander, L. I., Caputo, M., Solari, A., & Corach, D. (2020).

Genetic assignment of illegally trafficked neotro-

pical primates and implications for reintroduction

programs. Scientific Reports, 10(1), 3676. https://doi.

org/10.1038/s41598-020-60569-3

Páez, V. P., Morales-Betancourt, M. A., Lasso, C. A.,

Castaño-Mora, O. V., & Bock, B. C. (Eds.). (2012).

Biología y conservación de las tortugas continentales

de Colombia. Instituto de Investigación de Recursos

Biológicos Alexander von Humboldt.

Phillips, K. P., Jorgensen, T. H., Jolliffe, K. G., & Richardson,

D. S. (2017). Evidence of opposing fitness effects of

parental heterozygosity and relatedness in a critically

endangered marine turtle? Journal of Evolutionary

Biology, 30(11), 1953–1965. https://doi.org/10.1111/

jeb.13152

Restrepo, A., Páez, V. P., Bock, B. C., Daza, J. M., & Díazgra-

nados, I. (2014). Trachemys callirostris (Gray 1856).

En V. P. Páez (Ed.), Catálogo de anfibios y reptiles

de Colombia (pp. 7–12). Asociación Colombiana de

Herpetología.

Santos-Rodrigues, A. D. S., Galdino-Brandão, J. H. S.,

Araujó-Bitencourt, J. D., Jucá-Chagas, R., Sampaio,

I., Schneider, H., & de Mello-Affonso, P. R. A. (2016).

Molecular identification and traceability of illegal

trading in Lignobrycon myersi (Teleostei: Characifor-

mes), a threatened Brazilian fish species, using DNA

barcode. The Scientific World Journal, 2016, 9382613.

https://doi.org/10.1155/2016/9382613

Rosen, G. E., & Smith, K. F. (2010). Summarizing the

evidence on the international trade in illegal wildli-

fe. EcoHealth, 7(1), 24–32. https://doi.org/10.1007/

s10393-010-0317-y

Saldarriaga-Gómez, A. M., Ardila-Robayo, M. C., Medem,

F., & Vargas-Ramírez, M. (2023). Hope is the last

thing lost: Colombian captive-bred population of

the critically endangered Orinoco crocodile (Croco-

dylus intermedius) is a genetic reservoir that could

help to save the species from extinction. Nature

Conservation, 53, 85–103. https://doi.org/10.3897/

natureconservation.53.104000

Scheffers, B. R., Oliveira, B. F., Lamb, I., & Edwards, D. P.

(2019). Global wildlife trade across the tree of life.

Science, 366(6461), 71–76. https://doi.org/10.1126/

science.aav5327

Senko, J. F., Burgher, K. M., del Mar Mancha-Cisneros,

M., Godley, B. J., Kinan-Kelly, I., Fox, T., Humber,

F., Koch, V., Smith, A. T., & Wallace, B. P. (2022).

Global patterns of illegal marine turtle exploitation.

Global Change Biology, 28(22), 6509–6523. https://

doi.org/10.1111/gcb.16378

Sollund, R. (2017). The use and abuse of animals in

wildlife trafficking in Colombia: Practices and injus-

tice. In D. Rodríguez-Goyes, H. Mol, A. Brisman,

& N. South (Eds.), Environmental crime in Latin

America (pp. 215–243). Springer Nature. https://doi.

org/10.1057/978-1-137-55705-6_10

Stanford, C. B., Iverson, J. B., Rhodin, A. G. J., van Dijk,

P. P., Mittermeier, R. A., Kuchling, G., Berry, K. H.,

Bertolero, A., Bjorndal, K. A., Blanck, T. E. G., Buhl-

mann, K. A., Burke, R. L., Congdon, J. D., Diagne, T.,

Edwards, T., Eisemberg, C. C., Ennen, J. R., Forero-

Medina, G., Frankel, M., ... Vogt, R. C. (2020). Turtles

and tortoises are in trouble. Current Biology, 30(12),

721–735. https://doi.org/10.1016/j.cub.2020.04.088

Suárez-Giorgi, C. A. (2016). Diagnóstico del tráfico ile-

gal de fauna silvestre en jurisdicción de la Corpora-

ción Autónoma Regional de Cundinamarca – CAR,

departamentos de Cundinamarca y Boyacá, Colombia.

[Degree thesis]. Universidad Militar Nueva Gra-

nada. Repositorio Militar Nueva Granada. https://

repository.unimilitar.edu.co/server/api/core/

bitstreams/863990a5-4e1f-4d84-9046-d8c0e93b9e30/

content

Tonkin-Hill, G., Lees, J. A., Bentley, S. D., Frost, S. D. W., &

Corander, J. (2018). RhierBAPs: An R implementation

of the population clustering algorithm hierbaps. Well-

come Open Research, 3, 93. https://doi.org/10.12688/

wellcomeopenres.14694.1

Tow, J. H., Symes, W. S., & Carrasco, L. R. (2021). Economic

value of illegal wildlife trade entering the USA. PLoS

ONE, 16(10), e0258523. https://doi.org/10.1371/jour-

nal.pone.0258523

Vargas-Ramírez, M., Caballero, S., Morales-Betancourt, M.

A., Lasso, C. A., Amaya, L., Martínez, J. G., das Neves

Silva Viana, M., Vogt, R. C., Farias, I. P., Hrbek, T.,

Campbell, P. D., & Fritz, U. (2020). Genomic analyses

reveal two species of the matamata (Testudines: Che-

lidae: Chelus spp.) and clarify their phylogeography.

Molecular Phylogenetics and Evolution, 148, 106823.

https://doi.org/10.1016/j.ympev.2020.106823

24 Revista de Biología Tropical, ISSN: 2215-2075 Vol. 73: e00000, enero-diciembre 2025 (Publicado Abr. 28, 2025)

Vargas-Ramírez, M., Carr, J. L., & Fritz, U. (2013). Complex

phylogeography in Rhinoclemmys melanosterna: Con-

flicting mitochondrial and nuclear evidence suggests

past hybridization (Testudines: Geoemydidae). Zoo-

taxa, 3670(2), 238–254. https://doi.org/10.11646.

zootaxa.3670.2.8

Vargas-Ramírez, M., Maran, J., & Fritz, U. (2010). Red- And

yellow-footed tortoises, Chelonoidis carbonaria and

C. denticulam (Reptilia: Testadines: Testudinidae),

in South American savannahs and forests: Do their

phylogeographies reflect distinct habitats? Organisms

Diversity and Evolution, 10(2), 161–172. https://doi.

org/10.1007/s13127-010-0016-0

Vargas-Ramírez, M., Stuckas, H., Castaño-Mora, O. V., &

Fritz, U. (2012). Extremely low genetic diversity and

weak population differentiation in the endangered

Colombian river turtle Podocnemis lewyana (Testudi-

nes: Podocnemididae). Conservation Genetics, 13(1),

65–77. https://doi.org/10.1007/s10592-011-0263-4

Velo-Antón, G., Pereira, P., & Gonçãlves, D. V. (2021).

Genetic assignment of captive European pond

turtles (Emys orbicularis) increases conservation

value of recovery centres. Journal for Nature Con-

servation, 59(6), 125953. https://doi.org/10.1016/j.

jnc.2020.125953

Weeks, A. R., Sgro, C. M., Young, A. G., Frankham,

R., Mitchell, N. J., Miller, K. A., Byrne, M., Coa-

tes, D. J., Eldridge, M. D. B., Sunnucks, P., Breed,

M. F., James, E. A., & Hoffmann, A. A. (2011).

Assessing the benefits and risks of translocations

in changing environments: A genetic perspective.

Evolutionary Applications, 4(6), 709–725. https://doi.

org/10.1111/j.1752-4571.2011.00192.x

Witzenberger, K. A., & Hochkirch, A. (2011). Ex situ

conservation genetics: A review of molecular studies

on the genetic consequences of captive breeding

programmes for endangered animal species. Biodiver-

sity and Conservation, 20(9), 1843–1861. https://doi.

org/10.1007/s10531-011-0074-4